FEMS MicrobiologyReviews 104 (1993) 39-64 © 1993 Federation of European Microbiological Societies 0168-6445/93/$15.00 Published by Elsevier
39
FEMSRE 00248
Regulation and function of rhizobial nodulation genes Michael G6ttfert Mikrobiologisches Institut, Eidgen6ssische TechnischeHochschule Ziirich, Ziirich, Switzerland Received 25 May 1992 Revision received 19 August 1992 Accepted 24 August 1992
Key words: G e n e regulation; Nod factor; Nodulation genes; Rhizobia-legume interactions; Signaling
1. S U M M A R Y
2. I N T R O D U C T I O N
This review focuses on the functions of nodulation (nod) genes in the interaction between rhizobia and legumes. The nod genes are the key bacterial determinants of the signal exchange between the two symbiotic partners. The product of the nodD gene is a transcriptional activator protein that functions as receptor for a flavonoid plant compound. This signaling induces the expression of a set of nod genes that produces several related Nod factors, substituted lipooligosaccharides. The Nod factors are then excreted and serve as signals sent from the bacterium to the plant. The plant responds with the development of a root nodule. The plant-derived flavonoid, as well as the rhizobial signal, must have distinct chemical structures which guarantee that only matching partners are brought together.
In this review the term rhizobia includes all species of the genera Azorhizobium, Bradyrhizobium, and Rhizobium as Gram-negative soil bacteria able to establish a root nodule symbiosis with legumes. The bacteria differentiate into bacteroids within this nodule and then fix molecular nitrogen which the plant can use as its main nitrogen source. In turn, the plant supplies the bacteria with carbon (energy) sources. The study of the rhizobia-legume interaction has flourished for two main reasons: both partners can be easily handled separately and manipulated by standard molecular techniques, and secondly, the agronomical importance of many legumes has attracted interest in the basic functioning of this symbiosis. In an unprecedented effort, Allen and Allen [1] compiled 748 genera ( > 19000 species) of the Leguminosae and incorporated a survey of the existing nodulation data. Rhizobia are able to survive in the soil for years without requiring a host plant [2]. The prerequisite for rhizobia to live as symbionts,
Correspondence to: M. G6ttfert, Mikrobiologisches Institut, Eidgen6ssische Technische Hochschule Ziirich, Schmelzbergstrasse 7, CH-8092 Ziirich, Switzerland.
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
40
however, is that the plant is able to communicate with them (signal molecules in plant-microbe interactions are reviewed in [3,4]). Figure 1 illustrates interactions between rhizobia and their host plants. Legumes excrete flavonoids into the rhizosphere. The rhizobia react to that signal with the induction of nodulation (nod) genes. The concerted action of the nod gene proteins results in the production of substituted lipo-oligosaccharides (collectively called Nod factors). These Nod metabolites represent signals that the bacterium sends to the plant. They trigger the first
visible sign of a beginning symbiosis, the curling of root hairs, a phenomenon known for many years ([5] and references cited therein). Bacteria are guided via infection threads into the root cortex in the further course of the infection process [6,7]. Plant cells there have already started to divide in response to the Nod factor, resulting in a characteristic root organ, the nodule. The plant is the main controller of nodule development at this stage [8], which is also indicated by the ability of certain alfalfa (Medicago sativa) plants to produce nodule-like structures even in the absence
Table 1 Taxonomy of rhizobia Genus
Species a
Azorhizobium [217]
A. caulinodans [217]
Bradyrhizobiurn [218] ¢
B. japonicurn [218] Bradyrhizobium sp. ( Parasponia )
Present nomenclature
Rhizobium [219] d
R. fredii [220] ( Sinorhizobium fredii ) R. galegae [222] R. leguminosarum biovar phaseoli [223] biovar trifolii [223] biovar viciae [223] R. loti [224]
Previous nomenclature
Sesbania R. japonicum
R. japonicum
Galega R. phaseoli [219] a R. trifolii [219] d R. legurninosarum [219] d
R. leguminosarum
Rhizobium sp. strain
Phaseolus Trifolium Pisum, l,qcia Lotus, Lupinus Melilotus, Medicago Phaseolus, Leucaena Leucaena, Macroptilium, Vigna
NGR234 [226] f
S. fredii [24]
Glycine, ~gna
(fast growing strains) [221]
biovar phaseoli (type II strains) [225] d
Sinorhizobium [24] g
Glycine, ~gna
(slow growing strains) [219] d
R. meliloti [219] d R. tropici ~ [225]
Typical host genera b
R. fredii [220]
Glycine
a Only species relevant for this review are listed. b The list of host plants is not complete. The host range may extend beyond that given here and may differ a m o n g species of a genus. c For Bradyrhizobium strains other than B. ]aponicum it was suggested that they be referred to as Bradyrhizobium sp. with the name of the host plant in parentheses immediately following [218], e.g., Bradyrhizobium sp. (Parasponia). d A n d further references therein. The older designation was used throughout this review. f Probably, this strain belongs to R. fredii [25]. In this review no differentiation is made between the almost isogenic strains Rhizobiurn sp. strain NGR234 and strain MPIK3030 [227]. g See text for a recent dispute.
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
41 Plant root system . R e l e s ~ of nuffients . Production of adhesins (e.g. l e a n s ) - E x u d a l o n of flsvonoids
Rhizcb~ -G ~
p~oi~
- Chemolac~c response - Atlachment - Inducl~on of nodulaUon genes - Nod factor produclion
Nodule -
development
Induction of plant genes Root hair cuding Cor~caJ cell division Infec~on thread formaUon Invasion of plant cells Differenfml~n into beclmroids
3. T A X O N O M Y O F R H I Z O B I A Rhizobia are Gram-negative soil bacteria assigned to the alpha subdivision of the Proteobacteria (for reviews see [21,22]). Three genera (Azorhizobium, Bradyrhizobium and Rhizobium) have been defined at present (Table 1). Bradyrhizobium and Azorhizobium are more closely related to each other and to the non-symbiont Rhodopseudornonas palustris than to Rhizobium [23] based on r R N A hybridization and sequence studies. The assignment of R. fredii to the new genus Sinorhizobium [24] has been criticized recently [25]. The diversity found in rhizobia by D N A hybridization and physiological studies indicates that the nomenclature will need further refinement [26-30], and a minimal standard for the description of new genera has been proposed [31]. Table 1 summarizes the nomenclature of rhizobia. Previous nomenclature is included as well to facilitate comparison with the earlier literature.
4.
EARLY
EVENTS
IN
THE
RHIZOBIA-
LEGUME INTERACTION
Fig. 1. Rhizobia-legume interactions. Events prior to the infection of root hairs are discussed in this review. Nodule development is reviewed in [6-8].
4.1. Chemotaxis
of Rhizobium [9,10]. Several plant genes that are involved in nodule development have been identified [11]. The culmination of the nodulation process is a fully differentiated, nitrogen-fixing root nodule [12,13]. There are many other bacterial genes involved in the establishment of an effective symbiosis in addition to nod genes (reviewed in [14-20]). This review summarizes our present knowledge of nodulation genes. Short sections concerning chemotaxis and the attachment of rhizobia to their host plants describe the very early events in rhizobia-legume interactions. A survey of the current rhizobial taxonomy is included as well to facilitate the comparison with the literature.
Rhizobia are peritrichously or subpolarly flagellated bacteria [32] that can react to chemical gradients. Many substances present in root exudate such as carbohydrates, amino acids, carboxylic acids and phenolic compounds have been identified as chemoattractants that will promote the colonization of the rhizosphere [33-41]. In R. meliloti, motility and chemotaxis are not essential for nodulation, but important for full competitiveness [42,43]. R. meliloti is attracted to localized sites on the surface of alfalfa roots [44,45]. Bergman et al. [46] obtained R. meliloti mutants that had lost the chemotactic response to carbohydrates or amino acids, but were still able to attach to localized sites on the root. These authors concluded that a second, independent chemotactic pathway exists. Interestingly, this second pathway may be used by luteolin, a flavonoid, which is not only a potent inducer of nod genes in R. meliloti [47], but also a c h e m o a t -
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
42 mediated by bacterially produced cellulose fibrils, leads to a characteristic cap formation on root hair tips [52]. These cellulose fibrils, however, are not required for nodulation [52]. The carbonlimiting growth conditions used in these experiments led contrarily to an impaired infectivity of the rhizobia [55]. Infectivity increases if the bacteria are sufficiently supplied with a carbon source but Mn 2÷limited. Pea lectin is involved in the attachment process in this case [55]. Lectins are carbohydrate-binding proteins that have already been suggested as determinants of host specificity in the Rhizobium-clover (Trifolium) [56] and B. japonicurn-soybean ( Glycine max) [57,58] symbiosis. This was also indicated by the results of Diaz et al. [59]. They introduced a gene encoding pea lectin into white clover (Trifolium repens) roots by means of Agrobacterium rhizogenes. The resulting hairy clover roots could be infected by R. leguminosarum bv. viciae, though most nodules had an abnormal morphology. Lectins produced by the rhizobia may also be involved in attachment. H o et al. [60,61] showed that binding of B. japonicum to cultured soybean cells requires a bacterially produced lectin.
tractant [48]. The nodulation genes are probably not involved in this chemotactic response [49]. Chemotaxis towards nod gene-inducing flavonoids was also reported for Rhizobium leguminosarum strains [33,50]. In this case, the symbiotic plasmid, which carries all known nod genes, was beneficial, but not essential, for chemotaxis [50]. In contrast, none or only a very weak chemotaxis towards inducers of nod gene transcription was detected in B. japonicum [34,40].
4.2. Attachment The infection process requires the attachment of the rhizobia to the root cell surface (reviewed in [7,51]). The interaction between R. leguminosarum bv. viciae and pea (Pisum sativum) is by far the best studied system for the attachment of rhizobia to the root hair. Under limited carbon conditions, the first step in attachment, which is mediated by a rhicadhesin that is located at the surface of the bacterial cell [52,53]. Rhicadhesin is a small Ca :+ dependent protein (,,, 14 kDa) that probably anchors the adhesin to the rhizobial cell surface [53,54]. It is ehromosomally encoded [53] and most likely exists in other rhizobia as well [53]. The second step in attachment, which is
bv.
I:1. l e g u m i n o s a r u m o
T N M 4-- ~- <
L
~
~
E F
viciae
D A B C
~-
~-~--~
ikb
I JrX~
~--~j
S. j a p o n i c u m A* ~1--
D2
D1 Y A B
~
~1---t
4
I
C S ,
~ M
F* G* H* I* N ". - - ~ - - ~
-~ ~
~
D1 A B C ~
-~-t~--~-~
-
U ~
I J
Z
~
Ft. m e l i l o t i I
J
W ~- - ~
2 3
Q ~
V
---II~ l /
P G ~--4-
E F H ~.
~. --~
~ syrM ~--
193 ~
L //
~- //
6 D2 4---
Fig. 2. Organization of nodulation genes in Rhizobium and Bradyrhizobium species. Nodulation genes marked with an asterisk have the designation nol. nodX is not present in all R. leguminosarurnstrains and therefore was put in brackets. Open triangles above the gene symbols depict the location and orientation of nod boxes. The nodulation genes are summarized in Table 2. Their functions are discussed in sections 7 and 8.
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
43 Table 2 Nodulation genes identified in Azorhizobium, Bradyrhizobium and Rhizobium strains Gene
Species a
Molecular mass of the gene product h (kDa)
nodA
Ac [228]; Bj [193,229]; BsP [64]; Rf [230]; Rg [231]; Rlbv [232]; Rlbp [233,234]; Rlbt [63]; Rio [235]; Rm [236,237]; NGR234 [202,238] Ac [228]; Bj [193,229]; BsP [64]; Rf [230]; Rg [231]; Rlbv [232]; Rlbp [233,234]; Rlbt [63]; Rio [239]; Rm [236,237]; NGR234 [202,238] Ac [228]; Bj [193,229]; BsP [64]; Rf [230]; Rg [231]; Rlbv [232]; Rlbp [233,234]; Rlbt [63]; Rio [235]; Rm [237,240]; NGR234 [202,238] Ac [75]; Bj [85]; BsP [64]; NGR234 [104]; Rf [84]; Rg [231]; Rlbp [82,233]; Rlbt [63]; Rlbv [88]; Rm [77,236] Bja [85]; NGR234 [142,200]; Rf [84]; Rlbp [82]; Rm [77,80] Rlbp [82]; Rm [73,117] Rlbp [233]; Rlbt [157]; Rlbv [88]; Rm [127,153,154] Rlbt [63]; Rlbv [88]; Rm [127,153,154] Rm [127,153,154] Rm [127,153,154] Bj [176]; Rlbp [233]; Rlbt [191]; Rlbv [175]; Rio [241] Bj [176]; Rlbp [233]; Rlbt [191]; Rlbv [175]; RlbvT [165] BsP [64] Rlbt [162,163,191]; Rlbv [162,163]; Rm [161] Rlbt [169]; Rlbv [163]; Rm [167] Rlbt [191] Rlbv [163]; Rm [167] Rlbv [186,187] Rm [170,171] Rm [170,171] Rlbt [191] Bj [176]; NGR234 [192] Rlbt [184]; Rlbv [184] Bj [176]; NGR234 [192] Bj [198] Bj [198] Rlbt [165,191,242]; RlbvT [165] Bj [115,193] Bj [193] Bj [195] Rf [196] Rlbp [82] Rm [167] Rm [167] Rm [167] Rm [167] Rlbp [82] Rm [118] Rm [72,73]
22-25
nodB
nodC
nodD1 nodD2 nodD3 nodE nodF nodG nodH nod1 nodJ nodK nodL nodM nodN nodO nodP nodQ nodR nodS nodT nodU nodV nodW nodX nodY nodZ nolA nolC holE nolF nolG nolH noll nolP nolR syrM c
23-25
44-47
34-39 35-37 34; 35 42 10 26; 27 29 34-37 28 15 19; 20 66 18 30 35 71 n.d. 23; 24 50; 51 62 99 25 41 24 n.d. 27 44 12 34 31 24 49 11 13 36
References refer preferentially to publications that include sequence data. Abbreviations for rhizobia: Ac, A. caulinodans; Bj, B. japonicum; BsP, Bradyrhizobium sp. (Parasponia); NGR234, Rhizobium sp. strain NGR234; Rf, R. fredii; Rg, R. galegae; Rlbp, R. leguminosantm by. phaseoli; Rlbt, R. leguminosarum by. trifolii; Rlbv, R. leguminosarum bv. ~'iciae; RlbvT, R. leguminosarum by. z:iciae strain Tom; RIo, R. loft; Rm, R. meliloti. h Deduced from nucleotide sequence data. Abbreviation: n.d., not determined. c syrM is involved in nod gene regulation, and thus can be regarded as a nodulation gene.
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
44
5. C O M P E N D I U M OF N O D U L A T I O N G E N E S Several research groups investigating rhizobiaplant interactions have concentrated their efforts on studying the molecular basis of signal exchange in the very early stage of this interaction. This has led to the identification and characterization of a large number of nodulation genes. Nodulation genes were named nol when all letters of the alphabet were used up in the nod gene designations. Table 2 summarizes all known nod~no! genes (in this review, the term nod is used to refer to nodulation genes in general). Figure 2 illustrates the genomic organization of nodulation genes of three selected species.
6. T R A N S C R I P T I O N A L NODULATION GENES
REGULATION
OF
6.1. Nodulation genes are activated by NodD in the presence of a plant signal Nodulation genes in many rhizobia are clustered and organized in several operons (Fig. 2). Most of the operons are preceded by a promoter that contains highly conserved DNA regions, the so-called nod box [62-64], and thus share a similar mode of regulation. The product of the gene nodD binds to the nod box [65-70] and acts as a transcriptional regulator. Many species carry several, very similar (60-90% identity) homologs of nodD (Table 2). R. meliloti contains an additional
Table 3 Inducers of nod gene expression in rhizobia Compound a
Responding species b
7,4'-Dihydroxyflavone 5,7,4'-Trihydroxyflavone (apigenin) 7,3 ',4 '-Trihydroxyflavone 3,7,3',4'-Tetrahydroxyflavone (fisetin) 5,7,3'.4'-Tetrahydroxyflavone (luteolin) 3'-Methoxyluteolin (chrysoeriol) 3,5,7,4'-Tetrahydroxyflavone (kaempferol) 3,5,7,3 ',4'-Pentahydroxyflavone (quercetin) 3,5,7,3',4',5 '-Hexahydroxyflavone (myricetin) 7,4'-Dihydroxyflavanone (liquiritigenin) 5,7,4'-Trihydroxyflavanone (naringenin) 7,3'-Dihydroxy-4'-methoxyflavanone 5,7,3'-Trihydroxy-4'-methoxyflavanone(hesperitin) 3,5,7,3'-Tetrahydroxy-4'-methoxyflavanone 5,7,3 ',4'-Tetrahydroxyflavanone (eriodictyol) 3,5,7,3',4',5'-Hexahydroxyflavylium (delphinidin) 3,5,7,4',5'-Pentahydroxy-3'-methoxyflavylium(petunidin) 3,5,7,4'-Tetrahydroxy-3',5'-dimethoxyflavylium(malvidin) 6,3',4'-Trihydroxyaurone (sulfuretin) 7,4'-Dihydroxyisoflavone (daidzein) 5,7.4'-Trihydroxyisoflavone (genistein) 7-Hydroxyisoflavone 5,7-Dihydroxyisoflavone 5,7-Dihydroxy-4'-methoxyisoflavone (biochanin A) 3,9-Dihydroxycoumest an (coumestrol) 4,4'-Dihydroxy-2'-methoxychalcone
Bj [243]; NGR234 [244]; Rlbt [245]; Rm [107] Bj [115,243]; Rlbt [98]; Rlbv [99]; Rm [47] Rlbv [99] Rm [102] Rlbv [99]; Rm [47] Rm [246] Rlbp [247] Rlbp [247] Rlbp [247] Ac [248]; Rlbt [98]; Rm [107] Ac [75]; NGR234 [244]; Rlbp [81,249]; Rlbv [99]
Rlbv [250] Rlbv [99] Rlbv [250] Rlbp [249]; Rlbv [99] Rlbp [247] Rlbp [247] Rlbp [247] Rm [102] Bj [115,243,251]; NGR234 [244] Bj [115,243]; Rlbp [81.249] Bj [243] Bj [243] Bj [1151 Bj [243] Bj [85]; Rlbt [92]; Rlbv [92]; Rm [107]
Only the most potent inducers are listed. Additional inducers are recorded in the literature cited. b Abbreviations for rhizobia: Ac, A. caulinodans; Bj, B. japonicurn; NGR234, Rhizobium sp. strain NGR234; Rlbp, R. legurninosarum by. phaseoli; Rlbt, R. leguminosarum bv. trifolii; Rlbv, R. leguminosarum bv. L,iciae; Rm, R. meliloti.
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
45
regulatory gene, syrM (symbiotic regulator [71]). The sequence of syrM shows similarity to nodD and may be regarded as an additional nodD copy [72,73]. The effect of a nodD mutation on nodulation is strain-specific. R. leguminosarum bv. viciae, R. leguminosarum bv. trifolii, and probably Azorhizobium caulinodans have only one nodD gene, and nodD mutants are N o d - on all host plants [74-76]. Mutations in one of the three nodD homologs of R. meliloti reduce nodulation efficiency in a host-dependent manner [77-80]. Three functional nodD genes also exist in R. leguminosarum bv. phaseoli [81,82]. Rhizobium fredii USDA191 and B. japonicum harbor two nodD copies; NodD1 is the activator of nod genes, whereas no such function could be assigned to NodD2 [83-85]. Activation of nod gene transcription by the NodD protein (Fig. 3) requires the additional presence of root exudate [76,86-88]. Flavonoids have been identified as the inducing substances. Flavonoids are products of the secondary metabolism and almost ubiquitous in the plant kingdom. Their most prominent roles are in
3 t
8
2~4
' 5'
7
3'
' Jf':.T-7" v
0
0
Flavone 3
8
7 2' 65 ~ ~ 3 '
4'
5
5' 0
5'
I::~cone
2 7
3'
~ 8 + 5
4
0
5'
4
10
Ravyliumca'don
(~~n)
9
Cottne~nn
3' 4' ~5'
7
3
5
4'
S 54 ~
-'-/
0 ~r~e
O NodD + flavonoid
! not/
I nod boxl
~ genes
repressor Fig. 3. Regulation of nod gene expression. So far, a repressor gene has been identified only in R. meliloti (cf. 6.2.). The depicted flavonoid is 4,4'-dihydroxy-2'-methoxychalcone. Other inducers are listed in Table 3.
Fig. 4. Basic structures of flavonoids. Hydroxylation patterns and positions of other substituents can be deduced from Table 3.
flower and fruit coloration; and some act as phytoalexins. Distribution, function and metabolism of flavonoids are very thoroughly studied and more information may be obtained from two recent treatises [89,90]. Table 3 lists the major inducers of nod gene induction. Their chemical structures are shown in Fig. 4. Potent inducers already act at concentrations < 1 /zM. The presence of sub-optimal concentrations of different inducers may result in a synergistic increase in gene expression [91]. R. leguminosarum bv. viciae is not only an acceptor of compounds provided by
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
46
the host, Vicia sativa, but also triggers the plant to release additional flavonoids [92-94]. Soybean, however, does not seem to excrete more inducer after inoculation with B. japonicum [95]. Flavonoids act not only as inducers, but can also stimulate bacterial growth [96]. Rhizobia differ in their acceptance of flavonoids as inducers, as can be deduced from Table 3. Moreover, flavonoids can also repress nod gene induction [97-101], e.g., daidzein and genisrein, both being strong inducers in B. japonicum (Table 3), are potent inhibitors of gene expression in R. leguminosarum bv. viciae [99] and R. meliloti [102]. The decision about which flavonoid acts as an inducing molecule, i.e., which flavonoid has the suitable hydroxylation pattern and steric arrangement of the ring system, depends on the nature of the nodD copy [102-106]. An impressive example is R. meliloti, which contains three nodD copies plus the nodD homolog syrM (Table 2). NodD1 induces the nod genes in the presence of luteolin [47]. NodD2 interacts with methoxychalcone [103,107] and some, so far unknown compounds [78,80,108]. NodD3 is also able to interact with inducers [102], but, in combination with SyrM (if the corresponding genes are present on a plasmid), does not need an inducer molecule for nod gene activation [71,73,108]. 4,4'-Dihydroxy-2'-methoxychalcone is an interesting inducer in this respect. It is the only example of a flavonoid that is a very strong inducer in R. meliloti [103,107], B. japonicum [85] and R. leguminosarum strains [92]. One of the ring systems is opened in chalcones (Fig. 4), leading to an enhanced spatial flexibility. It may be this increased flexibility which allows the molecule to interact with different NodD proteins. The fact that individual NodD proteins differ in their preference for certain flavonoids suggests that the receptor protein is in direct contact with the inducer. Recourt et al. [109] have demonstrated that the inducer naringenin accumulates in the cytoplasmic membrane of R. leguminosarum bv. viciae. In conjunction with the observation that NodD is a membrane-associated protein [110], the cytoplasmic membrane is the most likely place where inducer and regulator will meet.
Point mutations within NodD can drastically change its regulatory functions; they may yield a protein that activates nodulation genes even in the absence of any inducer [111-113]. Studies with chimeric NodD proteins (in which the Nterminal and C-terminal regions originate from different species) indicate that the C-terminus is the major site of interaction [104,114] with the flavonoid. The NodD proteins vary not only in flavonoid specificity, but also in the genes that are differently regulated, nodD can be either negatively autoregulated [87], autoactivated, activated by other nodD copies [73,81,115,116], or constitutively expressed [76,81,86]. nodD expression can also be affected by syrM [73,108,117] and the repressor gene nolR [67,118] in R. meliloti. O t h e r environmental parameters, besides flavonoids, such as the ammonium concentration [119,120] and the pH [121], have been reported to influence nod gene expression.
6.2. The promoter region of nodulation genes The NodD protein belongs to the LysR family of bacterial activator proteins and has a helixturn-helix DNA binding motif near its N-terminus [122]. NodD is most homologous to the NahR protein, which is the transcriptional activator of genes required for naphthalene or salicylate metabolism in Pseudomonas putida [123,124]. The NahR binding site on DNA [123] exhibits similarity to the nod box promoter, which is the binding site for NodD. The nod box consists of three highly conserved nucleotide stretches with an entire length of 47 nucleotides and a fourth, less well conserved element, which occurs at a variable distance from the other conserved regions (Fig. 5). Goethals et al. [68] analyzed the promoter regions of genes regulated by members of the LysR family and identified the motif T - N n - A as typical element of these promoters (Fig. 5). The nod box becomes almost or completely inactive upon changing the spaces between the conserved elements by 4 or 6 bp, whereas it remains active if 10 bp are inserted [125,126]. This emphasizes the importance of a correct spatial arrangement of the conserved elements. Figure 5 depicts those nod boxes that have an al-
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
47
1 Cons
Rm n5 Rm n6 RlbpB Bj D1
2
3
4
NNYUYU N Y N TCNAAACAATCUATTTTACCAATCY 1-13 bD T(TIAG IATCCA~CCGCGCG IGATAIAAGGT.~ ~TCCAAACAATCGATTTTAC.T, JkATCA ~13 bp IATAG [ATCCA~TAGCG&7~A~GATG]ATTGT~. I~CCAAACAATCGATTTTCACA~TCC [I bp IATTAG IATCTAIT.~GCGTG [GATG~GGTATC ~ATCCAAACAATCGATTTTAC&7~LATTG [13 bp [ATTAG ATCGTG .IGCGCGTCTAATTGCTTTTTCCAAACT
Fig. 5. Consensus and unusual nod box sequences of rhizobia. Only sequences that deviate from the consensus sequence by the spacing of the conserved elements are indicated. Abbreviations: Cons, consensus sequence as proposed by Spaink et al. [252]; the bases which correspond to the LysR promoter motif (T-NlI-A) are indicated by asterisks [68]. Rm n5 and Rm n6, nod box sequences of R. meliloti [62]; RlbpB, nod box preceding the nodBC operon of R. leguminosarum bv. phaseoli [234]. BjD1, nod box promoter of nodD1 of B. japonicum, no upstream or downstream conserved elements were identified [126]. Bases differing from the consensus are underlined. Gaps are indicated by dots.
tered spacing. Unfortunately, their relative prom o t e r strengths have not been studied. The nod box most deviated from the consensus structure has been suggested for nodD1 of B. japonicum ([126]; Fig. 5), but N o d D binding has not been demonstrated yet. It was reported, however, that the 3' portion of the nod box has N o d D binding capacity in vitro [65] and p r o m o t e r activity in vivo [126]. In this context it will be interesting to unravel the regulation of R. rneliloti nodD3 in which nodD1, nodD3 and syrM participate because no nod box was found upstream of nodD3 [72,73,108,117]. The transcriptional start site of nodulation genes was m a p p e d approximately 25 bp downstream of the third conserved element of the nod box [65,68,126,127,186,207]. The transcriptional starts of R. leguminosarum bv. t,iciae nodA, R. meliloti nodA and B. japonicum n o d Y overlap with the p r o m o t e r regions of the divergently transcribed nodD1 genes [126,128,207], which also influences gene expression. Gel retardation experiments show that N o d D binds to the nod box in the presence or absence of the inducer [65,66]. In R. meliloti strain 41 and A. caulinodans, however, the addition of inducer supports complex formation [67,68]. In footprint experiments, about 55 bp of DNA, including the conserved elements of the nod box, are protected by N o d D [67,129]. T h e protected region is very large for a 35-kDa protein. N o d D may therefore bind as a dimer or tetramer. T e t r a m e r formation was demonstrated for N a h R [130] and CysB [131], both m e m b e r s of the LysR family [122]. In many strains of R. meliloti, a repressor
protein, NolR, is involved in nod gene regulation [67,118]. NolR, which contains a helix-turn-helix motif, binds downstream of the nodA nod box and to the nod box fragment adjacent to nodD2 of R. meliloti [67]. Interestingly, this interaction is weaker if the nod gene expression is induced by luteolin [67]. A mutation within the repressor gene results in a delayed nodulation phenotype [67]. Thus, nolR contributes to the fine-tuning of nod gene expression. No repressor gene has been identified in other rhizobia to date. Hybridization studies suggest that nolR does not exist in R. leguminosarum bv. ~,iciae. It was shown, however, that the chromosomal background in R. leguminosarurn strongly influences the expression of nod genes, indicating that an additional regulator may act in some R. leguminosarum strains as well [132].
6.3. Expression of nodulation genes in nodules In R. leguminosarum by. viciae and R. meliloti, the nodulation genes are still expressed in the invasion zone, but not in the late symbiotic zone, in which the bacteria have differentiated into bacteroids [133,134]. The nodD transcript was the only nod transcript which was still detectable in bacteroids [133]. Schlaman et ai. [133] also used a nodD mutant strain that encoded an inducer-independent transcriptional activator. The nod genes of this strain, however, were also turned off in the mature nodule. This indicates that nod gene expression is inhibited in the nodule. The immunological detection of the NodA, NodB and NodC proteins in mature nodules by Schmidt et al. [135] and John et al. [136] appears
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
48
to contradict the results obtained on nod gene expression. A useful control, in order to exclude any cross-reaction with other proteins, could be to co-inoculate the plants with a mixture of a nodABC deletion strain and a strain that initiates nodule development, but otherwise is unable to invade the nodule. Nodules should thus be occupied exclusively with the nodABC deletion strain and nodules should not contain any N o d A B C proteins.
NodL
H
CH OH ~2
~
I
H
CH OH 2
H
CH
I
I
I
(~ 3
CH3
OH3
NodRIv-IV p,c,C18:4)
<
NodM
NodRmqV (Ac,S.C16:2)
4__.._NodPQ
//"
/.
7. NOD B O X - A S S O C I A T E D N O D U L A T I O N G E N E S A N D T H E I R R O L E IN S I G N A L P R O DUCTION
NodH
NodFE N~G 2)3
7.1. The Nod factors of Rhizobium meliloti and Rhizobium leguminosarum biocar viciae Lerouge et al. [137], in their seminal work, resolved the first structure of a Nod factor, a sulfated and acylated glucosamine tetrasaccharide, N o d R m - I V (S,C16:2) from R. rneliloti (Fig. 6; the O-acetyl substituent at carbon 6 of the terminal non-reducing sugar was not described in the original paper). R. rneliloti additionally produces several related Nod factors [138,139] (Fig. 6). The presence of some of these factors may be due to the use of nod gene-overexpressing strains. R. rneliloti makes very low quantities of these Nod metabolites. The aforementioned authors created overproducing strains ( ~ 1000-fold increase [139]) to allow a structural evaluation. Overexpression of nod genes may lead, however, to an unbalanced amount of gene products, which, in turn, may cause structural deviations from the wild-type factor. The Nod factors of R. leguminosarum bv. L'iciae ([140,141]; Fig. 6) and probably of Rhizobium sp. strain NGR234 [142] belong to the same family of oligosaccharides. The purified Nod factors alone are able to elicit plant responses. N o d R m - I V (S,C16:2) causes root hair deformation on alfalfa even at 10-~l M concentration [137]. The factor induces nodule formation on alfalfa at higher concentrations (up to 10 -7 M) [143]. The pentasaccharides, e.g., N o d R m - V (S,C16:3), are less active on alfalfa but show increased root hair deformation
II
C~t3
\ CH 3
Fig. 6. Nod factors of R. meliloti and R. leguminosan4m bv. t'iciae [137-140]. The factors depicted here are those with the highest activity (see text). The nomenclature of Nod factors, e.g., N o d R m - l V (Ac, S,C16:2), uses the following abbreviations: Rm, strain which produces the factor; IV, n u m b e r of glucosamine residues, Ac, O-acetyl substituent; S, sulfate group; C16:2, acyl chain of 16 carbon atoms and 2 double bonds. Both strains produce additional Nod factors. The lengths of the oligosaccharide chain may vary (Rm-lll, R m - I V and R m - V in R. rneliloti; RIv-IV and RIv-V in R. leguminosarum bv. t'iciae) and the acyl chain may have a different degree of unsaturation (C16:2 and C16:3 in R. raeliloti; C18:4 and C18:1 in R. legurninosarum bv. t'iciae). The suggested functions of nod genes in Nod factor production are discussed in detail in section 7.2.
activity on Vicia satiL'a, which is not a host plant of R. meliloti [139]. Desulfation and hydrogenation of the double bond of the acyl chain render the factor inactive [143]. The most active Nod factors of R. leguminosarum bv. t,iciae, NodRIvV ( A c , C I 8 : 4 ) and NodRlv-IV(Ac,C18:4), elicit nodule meristems on V.. satiua [140]. Philip-Hollingsworth et al. [144] reported that R. leguminosarurn bv. trifolii produces and excretes N-acetylglutamic acid in a nod gene-dependent manner and that this compound may be involved in the infection process. The results of Philip-Hollingsworth et al. [144] need further confirmation considering the overwhelming evidence that the nod genes are responsible for the
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
49 production of the lipo-oligosaccharides and that these Nod factors are essential for nodule development. 7.2. Nodulation genes of known or suggested function in Nod factor production 7.2.1. nodA, nodB and nodC. The nodABC genes were the first nodulation genes identified. They exist in all rhizobia so far investigated. nodABC mutants can be complemented by the homologous genes from other species [145-148]. They are therefore also referred to as common nodulation genes. They are unique among nodulation genes (except nodD in some species) in that mutations within these genes lead to a strict N o d - phenotype on all host plants and prevent Nod factor production [137,140]. The nodA and nodB gene products are localized in the cytosol [135,149], but a membrane association was also suggested [150]. NodC is a transmembrane protein [136,150,151]. Addition of anti-NodC-specific antibodies to the inoculum results in a reduced nodulation [151]. NodA, NodB and a truncated form of NodC were detected by immunological assays in mature nodules of several plants [135,136]. In contrast, NodA could not be detected in nodules of Pisum sativum [133]. NodC has significant similarity to a chitin synthase of Saccharomyces [152]. Chitin is a linear polysaccharide consisting of N-acetyl-/3-1,4-D-glucosamine residues. NodC probably is a Nacetylglucosaminyl transferase, since the Nod factor has the same basic structure. Direct proof, however, is still lacking. 7.2.2. nodF, nodE and nodG. Mutations in nodFE cause a nodulation delay [153-155]. The nodF gene product is similar to the acyl carrier protein (ACP) of E. coli [88,153,154], and, like ACP, NodF carries a phosphopantetheine group [156]. The nodE gene product is located in the cytoplasmic membrane [157]. It is similar to fatty acid synthases of E. coli (FabB), Saccharomyces cerevisiae and a putative fl-ketoacyl synthase of Streptomyces species [158]. This suggests that nodF and nodE are involved in fatty acid biosynthesis. Indeed, a mutation within nodE of R. leguminosarum bv. viciae results in the replacement of the highly unsaturated acyl chain (C18 : 4)
by a mono-unsaturated (C18: 1) acyl chain [140]. This fatty acid probably originates from the pool required for the production of essential cell lipids [140]. A constitutive ACP has been characterized from R. meliloti [159]. nodG mutants are delayed [154] or hardly affected in nodulation [155]. NodG exhibits similarity to dehydrogenases [153], especially to oxidoreductases involved in polyketide synthesis [160]. Thus, nodG may also be involved in the synthesis of the acyl chain. 7.2.3. nodL and nodX. Mutations within nodL lead to a reduced or delayed nodulation [161163]. NodL shares similarity with acetyl transferases [164] and is essential for the O-acetylation of the Nod factor [140]. NodL is probably anchored in the cell membrane [162]. nodX is essential for the nodulation of Afghanistan peas by R. leguminosarum bv. viciae strain TOM [165]. NodX exhibits similarity to the Oac protein of the temperate bacteriophage Sf6 of Shigella flexneri [166]. This protein O-acetylates the lipopolysaccharide of Shigella flexneri [166]. NodX may therefore function as an acetyl transferase and modify the Nod factor. 7.2.4. nodM. nodM mutations do not strongly affect nodulation [162,163,167]. nodM shows similarity to glmS of E. coli, which encodes o-glucosamine synthetase, and is able to complement a glmS mutant [167]. A nodM mutant of R. leguminosarum bv. viciae produces about three-fold less of the Nod factor [141]. The 'housekeeping' glmS gene (glucosamine is indispensable for cell wall synthesis) must be able to compensate for the nodM mutation, and a glmS gene has been identified in R. leguminosarum [168], since nodM is not essential for the Nod factor production. Interestingly, in a R. leguminosarum bv. trifolii strain TA1 a nodM mutation enables the strain to nodulate Trifolium subterraneum cv. Woogeneilup [169]. nodM therefore behaves like a host specificity gene in this strain. Z2.5. nodP, nodQ and nodH. nodPQ mutants exhibit delayed nodulation [170,171]. The amino acid sequence of NodQ exhibits similarity to the GTP-binding domain of translational elongation factors. The significance of this similarity is not understood. Schwedock and Long [172] demon-
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
50 strated that NodPQ have ATP sulfurylase activity and that APS (adenosine 5'-phosphosulfate) kinase activity is located within the same region. These two activities are responsible for the generation of 3'-phosphoadenosine-5'-phosphosulfate (PAPS) in E. coli. PAPS is the activated sulfate group that is used in sulfur assimilation biosynthesis. NodH is membrane associated [173] and required for nodulation of alfalfa [153-155]. NodH shows weak similarity to sulfotransferases [174]. Hence, the conclusion is that nodPQ, together with nodH, are responsible for sulfation of the Nod factor, which was proven by Roche et al. [174]. The result that nodH but not nodPQ mutants are N o d - can be explained by the finding that there exists an additional copy of nodPQ-like genes within the genome [171]. The involvement of this copy in Nod factor production was demonstrated [174]. 7.2.6, nodl and nodJ. nodl and nodJ are peculiar in that they exist in all rhizobia investigated and are well conserved; mutations within these genes, however, hardly affect n o d u l a t i o n [74,175,176] and do not interfere with Nod factor production [141]. The nodulation defect of a nodI mutant is more pronounced if the nodulation genes are located on a recombinant plasmid instead of on the indigenous Sym plasmid [175]. Based on sequence similarity, NodI and NodJ belong to a large family of multicomponent transport systems. Most of these systems accomplish the uptake of small solutes such as amino acids or sugars. The uptake systems generally consist of a periplasmic binding protein, two hydrophobic membrane proteins and one or two ATP-binding components which supply ATP as the source of energy for transport (reviewed in [177,178]). Neither the periplasmic nor the hydrophobic membrane spanning components show homology with other members of the family. The ATP-binding proteins, however, are similar ( ~ 30% amino acid sequence identity over their entire length). NodI has similarity characteristic of the ATPbinding proteins [175] and is associated with the cytoplasmic membrane [132]. NodJ is encoded within the same operon as NodI, highly hydrophobic, and could represent the integral mem-
Bj
25 32 39 46 53 NY~AWRKVA, hASLLGNJ,dkDPI TNLFGLGFGLGL
II II I I I I I I I I II I IIIll Ill Rlbt NY IAWKKAALASLLGHI~AE PL I Y L F G L G A G L G V
li
Iii
lllli
tl
ii
I ililllillilb
Rlbv N Y L A W K K A A L A S I LGNLADPVI YL FGLGAGLGV
-Fig. 7. N-terminal domains of the B. japonicum (Bj), R. leguminosarum by. trifolii (Rlbt) and R. leguminosarum by. viciae (Rlbv) NodJ proteins. Leucines with a spacing of seven residues are underlined. The numbering of amino acid positions is the same as in the complete sequence.
brane component. The integral membrane proteins are generally believed to function as dimers [178], suggesting that NodJ may exist as a homodimer. Interestingly, the N-terminus of NodJ contains a sequence reminiscent of a leucine zipper motif (Fig. 7). The leucine zipper motif has been identified mainly in eukaryotic transcription factors and is required for dimerization (reviewed in [179]). The notion that NodJ may use a similar motif for dimerization is of course rather speculative considering the lack of experimental evidence. A periplasmic binding protein typical for uptake systems has not been identified thus far. This suggests that nodlJ may be involved in export. Hemolysin of 17,. coli is an example of an export system that belongs to the same family. The export of the hemolysin protein is mediated by HIyD, TolC and HIyB, an ATP-binding, integral membrane protein ([180,181] and further references therein). It is unknown which substance might be transported by the NodlJ proteins. An obvious hypothesis is that they are involved in the export of the Nod factor, a lipo-oligosaccharide. The oligosaccharide moiety requires a transport system. Experimental data that would support this idea are, however, not available. Nevertheless, the conservation of these two genes in different rhizobia suggests that they serve an important function, although mutations do not result in a strong nodulation defect under laboratory conditions. It is possible that the cell can substitute for this function by another housekeeping transport system.
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
51
7.3. Nodulation genes of unknown function 7.3.1. nodN, nodT, nolE, nolF, nolG, nolH, nolI and nolP. In R. meliloti, nodN, nolF, nolG, nolH and nolI form an operon together with nodM [167]. Mutations within this operon lead to a delay in nodulation on Medicago but have no effect on Melilotus [167]. Mutations in nodN of R. leguminosarum bv. viciae hardly affect nodulation [163]. No function has been proposed for these genes. NolG, NolH and NolI have some weak similarity to CzcA of Alcaligenes eutrophus, which is part of a divalent cation effiux system [182]. nodT is essential for the efficient nodulation of Trifolium subterraneum cv. Woogenellup [183]. Apart from that it hardly affects nodulation [162,184] and does not influence Nod factor production [141]. NodT is predicted to be located in the outer membrane or the periplasmic space [184]. Mutations in nolE or nolP of R. leguminosarum bv. phaseoli do not affect nodulation [82]. NolE is probably exported into the periplasm [821. 7.3.Z nodO. nodO is special among the nod genes in that it encodes a secreted protein [185187]. The protein has similarity to hemolysin of E. coli [186,187] and is likely to be secreted by a similar mechanism [188]. A mutation in nodO hardly changes the nodulation behavior of R. leguminosarum bv. viciae [187,189]. The defect is more pronounced in the R. leguminosarum bv. trifolii chromosomal background [189] or in a nodE mutant background [187]. Nod factor production does not depend on nodO [141]. The finding that a R. leguminosarum bv. viciae strain lacking nodFEL, nodMNT and nodO is unable to nodulate lJicia hirsuta, but can be complemented by nodO alone [190], is quite puzzling. This may suggest that there is an additional mechanism by which nodule development is triggered. 7.3.3. nodR, nodS, nodU and nodZ. nodR was detected in R. leguminosarum bv. trifolii [191], but no further data are available. Mutants in the nodS and nodU genes downstream of B. japonicum nodYABC are Nod + [176]. In Rhizobium sp. strain NGR234, these genes
influence the host range and are essential for the nodulation of Leucaena leucocephala [192]. nodSU-like sequences also exist downstream of the nodC gene in A. caulinodans and in R. leguminosarum bv. phaseoli type II, and hybridization studies revealed similar sequences in Bradyrhizobium strains [176]. nodZ was identified by hybridization to a hsn locus of Rhizobium sp. strain NGR234 [193]. Mutations within nodZ result in a nodulation delay on Siratro [193]. 7.3.4. nodK and node In Bradyrhizobium sp. (Parasponia), nodA is preceded by nodK [64]. In B. japonicum, nodY is located at the same position ([193] and our own unpublished data). Both genes share some weak similarity, nodY is not essential for nodulation [194]. 8. N O D U L A T I O N G E N E S T H A T A R E N O T A S S O C I A T E D W I T H A NOD BOX
8.1. nolA The B. japonicum strain S D 6 - 1 c is unable to nodulate the soybean cultivar PI377578 [195]. Introduction of the nolA region into S D 6 - 1 c extends the host range to this genotype. The reason for this host range extension is unknown. The amino terminal end of NolA shows homology to transcriptional regulators and contains a putative DNA binding domain [195]. Thus, the introduction of nolA into strain S D 6 - 1 c may lead to an altered expression of genes involved in plant infection. 8.2. nolC Rhizobium fredii strain USDA257 fails to nodulate the soybean cultivar McCall, unless the strain carries a mutation within nolC, a gene which is expressed constitutively [196,197]. Mutants have a decreased nitrogen fixation ability with the soybean cultivar Peking. NolC has similarity with DnaJ, a heat-shock protein of E. coli [197]. The significance of this similarity, as well as the function of NolC, remain to be elucidated. 8.3. nodV and nodW Mutations in nodV and nodW of B. japonicum prevent nodulation of Vigna radiata, Vigna un-
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
52
guiculata and Maeroptilium atropurpureum; but nodulation of soybean is only delayed [198]. NodV and NodW show similarity to the sensor kinases and response regulators of the two-component regulatory systems, respectively [198]. This similarity suggests that NodV and NodW are involved in the transcriptional regulation of genes that are essential for nodule initiation. In the search for NodW-regulated genes in B. japonicum, we have recently identified a D N A region that, under special condition, is able to substitute for nodW (P. Grob and M. G6ttfert, unpublished observations).
9. U N C H A R A C T E R I Z E D GIONS
NOD G E N E RE-
9.1. nod regions in Bradyrhizobium japonicum Apart from the nod box in front of nodA, there are at least two additional nod boxes within the genome [194]. A deletion of only one of these nod boxes (and adjacent D N A material) led to a strongly reduced nodulation on mung bean (l/igna radiata) but not on other host plants [194]. Recent work in our laboratory indicates that the genetic information required for mung bean nodulation is located both downstream and upstream of this nod box (J. Fliickiger and M. G6ttfert, unpublished observations). Deshmane and Stacey [199] reported on a gene locus essential for soybean nodulation. The locus is located about 6 kb downstream of the nodD genes and its expression is inducible by flavonoids. 9.2. nod regions in Rhizobium sp. strain NGR234 Rhizobium sp. strain NGR234 (reviewed in [200]) deviates from other well characterized rhizobia in two respects: its nodulation genes are dispersed over the whole symbiotic plasmid or may be even chromosomally located [201-203] and secondly, it has an exceptionally broad host range. Three regions have been identified that are important for the host range extension to Macroptilium atropurpureum and several other host plants [204]. The HsnlI region has been recently shown to contain the nodSU genes ([192];
cf. 7.3.3.), the HsnlII region contains a nod box and the HsnI region is located close to nodD1.
9.3. nod regions in Rhizobiurn meliloti Rostas et al. [62] reported the identification of six nod box sequences in R. meliloti. Five of them are located upstream of known nodulation genes (Fig. 2). The n6 region, which in addition contains nodD2, is required for full nodulation efficiency [205]. 9.4. Prospects for the identification of novel nodulation genes In R. meliloti and R. leguminosarum strains, probably all of the nod box regions have been identified. A 32-kb D N A fragment of R. leguminosarum by. trifolii carries all of the genes required for induction of nitrogen-fixing nodules on clover [206]. The prospects of locating additional nodulation genes therefore look dim. Other species may, however, contain quite different sets of nodulation genes, e.g., nodS and nodU are not present in the aforementioned strains and may be involved in Nod factor production, nodV and nodW, which are probably involved in the regulation of nodulation functions and which were identified in B. japonicum, are another example. The reader should not be left with the impression that there are no other genes influencing nodulation. Long et al. [125] presented an interesting example for such a gene. They identified a gene locus essential for full NodD activity. The deduced gene product showed similarity to chaperonins. Chaperonins are members of a protein family required for correct folding or assembly of many other proteins.
10. N O D U L A T I O N G E N E S AS D E T E R M I NANTS O F H O S T SPECIFICITY
10.1. nodD as a determinant of host specificity The ability of a flavonoid to act as a nod gene inducer depends on the origin of the NodD protein (cf. 6.1.). Furthermore, the flavonoid composition of root exudates differs among plant species ([106]; see references in Table 3). This suggests that NodD could influence the host range by its
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
53 ability, or failure, to interact with a given inducer. Indeed it has been found that nodD mutations cannot always be complemented by nodD of a different origin [104,105]. On the other hand, R. meliloti nodulates the illegitimate host Macroptilium atropurpureum if it obtains the nodD gene of Rhizobium sp. strain MPIK3030 [104], which is an endosymbiont of this plant. R. leguminosarum bv. viciae is able to nodulate Trifolium pratense if it harbors the nodD gene of R. leguminosarum by. trifolii [105]. Point mutations within the nodD gene of R. leguminosarum by. trifolii that lead to an inducer-independent ability to activate nod gene expression were able to extend the host range of R. leguminosarum bv. trifolii to Parasponia [113]. Similarly, a hybrid nodD (nodD604), consisting of R. meliloti and R. leguminosarum by. trifolii nodD fragments, exhibits constitutive activation of nod genes. It extended the host range and increased the nitrogen fixation activity with Trifolium repens [207]. A host range extension by nodD can only be achieved of course if the bacterium is able to produce a Nod factor suitable for the plant species.
10.2. nod genes involved in Nod factor production The Nod factors are the signals which the rhizobia send to their host plants (cf. 7.1.). Mutations in nodulation genes that lead to a structural change of these signals may also change the host range of the bacterium, nodH is essential for the sulfation of the Nod factor (cf. 7.2.5.). A nodHstrain of R. meliloti fails to nodulate alfalfa. The mutant, however, gains the capability to nodulate vetch (Vicia sativa) [154,208]. The nonsulfated Nod factor is obviously more vetch-specific than the sulfated Nod factor. The observation that mutations in nodPQ, which are also involved in sulfation of the Nod factor, result in an extension of the host range to vetch [170] is also in agreement with this conclusion. The transfer of the R. meliloti host specificity genes nodFEGHPQ into R. leguminosarum bv. trifolii enables this strain to nodulate alfalfa, but blocks the nodulation of its normal host, white clover [209]. Mutations within nodFE, nodPQ and nodH restored the nodulation of clover to some
extent [170,209,210], indicating that sulfation of the Nod factor and the structure of the acyl chain are involved in host specificity. In the closely related R. legummosarum by. viciae and R. leguminosarum by. trifolii strains, the exchange of the nodFEL gene region changes the host range of the strains as well [211,212], nodE being the major host range determinant [157].
11. A R E T H E N O D F A C T O R S U N I Q U E SPECIES O F S I G N A L M O L E C U L E S ? The plant responds to the Nod factor with nodule formation. Moreover, the expression of nodA and nodB in transgenic tobacco plants leads to an altered cell differentiation, indicating that the nodAB gene products may interfere with normal cell signaling [173]. Thus, plants may use Nod factor related oligosaccharides for signal transduction. For some oligosaccharides it is already known that they elicit a plant response [213,214]. Similarities identified between NodC and two other proteins, DG42 and FBF15, further foster the idea that Nod factor related oligosaccharides may indeed be involved in signaling in other organisms ([152]; H. Schairer, personal communication). DG42 is a 70-kDa protein, detectable for ~ 1 day during embryogenesis of Xenopus laevis [215]. The FBF15 protein (45.5 kDa) is essential for the fruiting body formation in Stigmatella aurantiaca and very similar to NodC (H. Schairer, personal communication). Although the function of both proteins is still unknown, their occurrence at a very distinct developmental stage in morphogenesis of the corresponding organisms suggests their participation in signaling. The deduced gene product of an open reading frame (ORF) located downstream of the avrD (avirulence D) gene of Pseudomonas syringae pv. tomato [216] has similarity to N o d H of R. meliloti (25% identity). Pseudomonas syringae pv. glycinea strains that carry the avrD locus elicit a hypersensitive defense response on some soybean cultivars. The biochemical function of the O R F is unknown, but an involvement in signaling also seems possible.
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
54 12. C O N C L U S I O N S T r e m e n d o u s p r o g r e s s has b e e n m a d e in elucid a t i n g t h e signal e x c h a n g e in t h e early stage o f t h e r h i z o b i a - l e g u m e i n t e r a c t i o n s . R h i z o b i a have a c q u i r e d a set of nod g e n e s in o r d e r to c o m m u n i c a t e with t h e i r host p l a n t s p r i o r to a n d d u r i n g t h e infection process. T h e c e n t r a l role o f nodD in the r e c o g n i t i o n of t h e p l a n t signal, a flavonoid rel e a s e d into t h e r h i z o s p h e r e , a n d in nod g e n e r e g u l a t i o n has b e e n clarified. The unraveling of the chemical structure of the first N o d m e t a b o l i t e was a m i l e s t o n e in t h e research of rhizobia-legume interactions. The i d e n t i f i e d e n z y m a t i c activities of a few nod g e n e p r o d u c t s , t h e similarities of several nod g e n e s to g e n e s with k n o w n functions, t o g e t h e r with t h e o b s e r v e d effects o f nod g e n e m u t a t i o n s o n N o d factor p r o d u c t i o n a l r e a d y give g o o d i n d i c a t i o n s for t h e p a t h w a y o f N o d f a c t o r biosynthesis. T h e availability o f p u r i f i e d N o d m e t a b o l i t e s now p e r mits t h e analysis o f t h e so far u n k n o w n p l a n t r e c e p t o r . T h e similarity o f N o d C , a key d e t e r m i n a n t in N o d factor p r o d u c t i o n , to p r o t e i n s t h a t m a y be involved in signaling in o t h e r o r g a n i s m s , suggests t h a t t h e study o f t h e r h i z o b i a - l e g u m e i n t e r a c t i o n s m a y l e a d to a b e t t e r u n d e r s t a n d i n g of signaling in o t h e r o r g a n i s m s as well.
ACKNOWLEDGEMENTS I a m g r a t e f u l to P r o f e s s o r H. H e n n e c k e , Dr. L. T h 6 n y a n d Dr. M. Yaffee-M~ider for h e l p f u l sugg e s t i o n s d u r i n g t h e p r e p a r a t i o n of t h e m a n u s c r i p t .
REFERENCES [1] Allen, O.N. and Allen, E.K. (1981) The Leguminosae. The University of Wisconsin Press, Madison, WI. [2] Bottomley, P.J. (1992) Ecology of Bradyrhizobium and Rhizobium. In: Biological Nitrogen Fixation (Stacey, G., Burris, R.H. and Evans, H.J., Eds.), pp. 293-348. Chapman and Hall, New York, NY. [3] Halverson, L.J. and Stacey, G. (1986) Signal exchange in plant-microbe interactions. Microbiol. Rev. 50, 193-225. [4] Lugtenberg, B.J.J. (1989) Signal Molecules in Plants and Plant-Microbe Interactions. NATO ASI Series, Vol. 36. Springer, Berlin.
[5] Yap, P.Y. and Vincent, J.M. (1969) Host specificity in the root hair curling factor of Rhizobium spp. Aust. J. Biol. Sci. 22, 413-423. [6] Brewin, N.J. (1991) Development of the legume root nodule. Annu. Rev. Cell Biol. 7, 191-226. [7] Kijne, J.W. (1992) The Rhizobium infection process. In: Biological Nitrogen Fixation (Stacey, G., Burris, R.H. and Evans, H.J., Eds.), pp. 349-398. Chapman and Hall, New York, NY. [8] Caetano-Anoll6s, G. and Gresshoff, P.M. (1991) Plant genetic control of nodulation. Annu. Rev. Microbiol. 45, 345-382. [9] Caetano-Anoll6s, G., Joshi, P.A. and Gresshoff, P.M. (1990) Spontaneous nodules induce feedback suppression of nodulation in alfalfa. Planta 183, 77-82. ll0] Truchet, G., Barker, D.G., Camut, S., de Billy, F., Vasse, J. and Huguet, T. (1989) Alfalfa nodulation in the absence of Rhizobium. Mol. Gen. Genet. 219, 65-68. [11] Franssen, H.J., Nap, J.P. and Bisseling, T. (1992) Nodulins in root nodule development. In: Biological Nitrogen Fixation (Stacey, G., Burris, R.H. and Evans, H.J., Eds.), pp. 598-624. Chapman and Hall, New York, NY. [12] Phillips, D.A. and Teuber, L.R. (1992) Plant genetics of symbiotic nitrogen fixation. In: Biological Nitrogen Fixation (Stacey, G., Burris, R.H. and Evans, H.J., Eds.), pp. 625-647. Chapman and Hall, New York, NY. [13] Werner, D. (1992) Physiology of nitrogen-fixing legume nodules: compartments and functions. In: Biological Nitrogen Fixation (Stacey, G., Burris, R.H. and Evans, H.J., Eds.), pp. 399-431. Chapman and Hall, New York, NY. [14] Appelbaum, E. (1990) The Rhizobium/Bradyrhizobiurnlegume symbiosis. In: The Molecular Biology of Symbiotic Nitrogen Fixation (Gresshoff, P.M., Ed.), pp. 131158. CRC Press, Boca Raton, FL. [15] Barbour, W.M., Wang, S.P. and Stacey, G. (1992) Molecular genetics of Bradyrhizobium symbiosis. In: Biological Nitrogen Fixation (Stacey, G., Burris, R.H. and Evans, H.J., Eds.), pp. 648-684. Chapman and Hall, New York, NY. [16] Gray, J.X. and Rolfe, B.G. (1990) Exopolysaccharide production in Rhizobium and its role in invasion. Mol. Microbiol. 4, 1425-1431. [17] Kondorosi, A., Kondorosi, E., John, M., Schmidt, J. and Schell, J. (1991) The role of nodulation genes in bacterium-plant communication. In: Genetic Engineering (Setlow, J.K., Ed.), Vol. 13, pp. 115-136. Plenum Press, New York, NY. [18] Long, S.R. (1989) Rhizobium genetics. Annu. Rev. Genet. 23, 483-506. [19] Long, S.R. (1992) Genetic analysis of Rhizobium nodulation. In: Biological Nitrogen Fixation (Stacey, G., Burris, R.H. and Evans, H.J., Eds.), pp. 560-597. Chapman and Hall, New York, NY. [20] Reuber, T.L., Reed, J., Glazebrook, J., Glucksmann, M.A., Ahmann, D., Marra, A. and Walker, G.C. (1991)
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
55 Rhizobium meliloti exopolysaccharides: genetic analyses and symbiotic importance. Biochem. Soc. Trans. 19, 636-641. [21] Woese, C.R. (1987) Bacterial evolution. Microbiol. Rev. 51,221-271. [22] Young, J.P.W. (1992) Phylogenetic classification of nitrogen-fixing organisms. In: Biological Nitrogen Fixation (Stacey, G., Burries, R.H. and Evans, H.J., Eds.), pp. 43-86. Chapman and Hall, New York, NY. [23] Jarvis, B.D.W., Gillis, M. and de Ley, J. (1986) Intraand intergenic similarities between the ribosomal ribonucleic acid cistrons of Rhizobium and Bradyrhizobium species and some related bacteria. Int. J. Syst. Bacteriol. 36, 129-138. [24] Chen, W.X., Yah, G.H. and Li, J.L. (1988) Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned to Sinorhizobium gen. nov. Int. J. Syst. Bacteriol. 38, 392-397. [25] Jarvis, B.D.W., Downer, H.L. and Young, J.P.W. (1992) Phylogeny of fast-growing soybean-nodulation rhizobia supports synonymy of Sinorhizobium and Rhizobium and assignment to Rhizobium fredii. Int. J. Syst. Bacteriol. 42, 93-96. [26] Hollis, A.B., Kloos, W.E. and Elkan, G.H. (1981) D N A : D N A hybridization studies of Rhizobium japonicum and related Rhizobiaceae. J. Gen. Microbiol. 123, 215-222. [27] Rinaudo, G., Orenga, S., Fernandez, M.P., Meugnier, H. and Bardin, R. (1991) DNA homologies among members of the genus Azorhizobium and other stemand root-nodulating bacteria isolated from the tropical legume Sesbania rostrata. Int. J. Syst. Bacteriol. 41, 114-120. [28] Scholla, M.H., Moorefield, J.A. and Elkan, G.H. (1990) DNA homology between species of the rhizobia. System. Appl. Microbiol. 13, 288-294. [29] Stanley, J., Brown, G.G. and Verma, D.P.S. (1985) Slow-growing Rhizobiura japonicum comprises two highly divergent symbiotic types. J. Bacteriol. 163, 148154. [30] Zhang, X., Harper, R., Karsisto, M. and Lindstr6m, K. (1991) Diversity of Rhizobium bacteria isolated from the root nodules of leguminous trees. Int, J. Syst. Bacteriol. 41, 104-113. [31] Graham, P.H., Sadowsky, M.J., Keyser, H.H., Barnet, Y.M., Bradley, R.S., Cooper, J.E., de Ley, D.J., Jarvis, B.D.W., Roslycky, E.B., Strijdom, B.W, and Young, J.P.W. (1991) Proposed minimal standards for the description of new genera and species of root- and stemnodulating bacteria. Int. J. Syst. Bacteriol. 41,582-587. [32] de Ley, J. and Rassel, A. (1965) DNA base composition, flagellation and taxonomy of the genus Rhizobium. J. Gen. Microbiol. 41, 85-91. [33] Aguilar, J.M.M., Ashby, A.M., Richards, A.J.M., Loake, G.J., Watson, M.D. and Shaw, C.H. (1988) Chemotaxis of Rhizobium leguminosarum biovar phaseoli towards
flavonoid inducers of the symbiotic nodulation genes. J. Gen. Microbiol. 134, 2741-2746. [34] Barbour, W.M., Hattermann, D.R. and Stacey, G. (1991) Chemotaxis of Bradyrhizobium japonicum to soybean exudates. Appl. Environ. Microbiol. 57, 2635-2639. [35] Bowra, B.J. and Dilworth, M.J. (1981) Motility and chemotaxis towards sugars in Rhizobium leguminosarum. J. Gen. Microbiol. 126, 231-235. [36] Currier, W.W. (1980) Chemotaxis of a birdsfoot trefoil strain of Rhizobium to simple sugars. FEMS Microbiol. Lett. 8, 43-46. [37] Currier, W.W. and Strobel, G.A. (1977) The chemotactic behaviour of trefoil Rhizobium. FEMS Microbiol. Lett. 1,243-246. [38] Gaworzewska, E.T. and Carlile, M.J. (1982) Positive chemotaxis of Rhizobium leguminosarum and other bacteria towards root exudates from legumes and other plants. J. Gen. Microbiol. 128, 1179-1188. [39] G6tz, R., Limmer, N., Ober, K. and Schmitt, R. (1982) Mobility and chemotaxis in two strains of Rhizobium with complex flagella. J. Gen. Microbiol. 128, 789-798. [40] Kappe, R., Parniske, M. and Werner, D. (1991) Chemotaxis and nod gene activity of Bradyrhizobiurn japonicum in response to hydroxycinnamic acids and isoflavonoids. Appl. Environ. Microbiol. 57, 316-319. [41] Parke, D., Rivelli, M. and Ornston, L.N. (1985) Chemotaxis to aromatic and hydroaromatic acids: comparison of Bradyrhizobium japonicum and Rhizobium trifolii. J. Bacteriol. 163, 417-422. [42] Ames, P. and Bergman, K. (1981) Competitive advantage provided by bacterial motility in the formation of nodules by Rhizobium rneliloti. J. Bacteriol. 148, 728729. [43] Caetano-Anoll6s, G., Wall, L.G., de Micheli, A.T., Macchi, E.M., Bauer, W.D. and Favelukes, G. (1988) Role of motility and chemotaxis in efficiency of nodulation by Rhizobium meliloti. Plant Physiol. 86, 1228-1235. [44] Gulash, M., Ames, P., Larosiliere, R.C. and Bergman, K. (1984) Rhizobia are attracted to localized sites on legume roots. Appl. Environ. Microbiol. 48, 149-152. [45] Malek, W. (1989) Chemotaxis in Rhizobium meliloti strain L5.30. Arch. Microbiol. 152, 611-612. [46] Bergman, K., Gulash-Hoffee, M., Hovestadt, R.E., Larosiliere, R.C., Ronco II, P.G. and Su, L. (1988) Physiology of behavioral mutants of Rhizobium meliloti: evidence for a dual chemotaxis pathway. J. Bacteriol. 170, 3249-3254. [47] Peters, N.K., Frost, J.W. and Long, S.R. (1986) A plant flavone, luteolin, induces expression of Rhizobium rneliloti nodulation genes. Science 233, 977-980. [48] Caetano-Anoll6s, G., Crist-Estes, D.K. and Bauer, W.D. (1988) Chemotaxis of Rhizobium meliloti to the plant flavone luteolin requires functional nodulation genes. J. Bacteriol. 170, 3164-3169. [49] Dharmatilake, A.J. and Bauer, W.D. (1992) Chemotaxis of Rhizobium meliloti towards nodulation gene-inducing
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
56
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
[61]
[62]
compounds from alfalfa roots. Appl. Environ. Microbiol. 58, 1153-1158. Armitage, J.P., Gallagher, A. and Johnston, A.W.B. (1988) Comparison of the chemotactic behaviour of Rhizobium leguminosarurn with and without the nodulation plasmid. Mol. Microbiol. 2, 743-748. Lugtenberg, B.J.J., Diaz, C., Smit, G., de Pater, S. and Kijne, J.W. (1991) Roles of lectin in the Rhizobiurnlegume symbioses. In: Advances in Molecular Genetics of Plant-Microbe Interactions (Hennecke, H. and Verma, D.P.S., Eds.), Vol. 1, pp. 174-181. Kluwer Academic Publishers, Dordrecht. Smit, G., Kijne, J.W. and Lugtenberg, B.J.J. (1987) Involvement of both cellulose fibrils and a Ca2+-depen dent adhesin in the attachment of Rhizobium leguminosarum to pea root hair tips. J. Bacteriol. 169, 42944301. Smit, G., Logman, T.J.J., Boerrigter, M.E.T.I., Kijne, J.W. and Lugtenberg, B.J.J. (1989) Purification and partial characterization of the Rhizobium leguminosarurn biovar t'iciae Ca2+-dependent adhesin, which mediates the first step in attachment of cells of the family Rhizobiaceae to plant root hair tips. J. Bacteriol. 171, 40544062. Stair, G., Tubbing, D.M.J., Kijne, J.W. and Lugtenberg, B.J.J. (1991) Role of Ca 2÷ in the activity of rhicadhesin from Rhizobium legurninosarum biovar viciae, which mediates the first step in attachment of Rhizobiaceae cells to plant root hair tips. Arch. Microbiol. 155, 278283. Kijne, J.W., Smit, G., Diaz, C.L. and Lugtenberg, B.J.J. (1988) Lectin-enhanced accumulation of manganeselimited Rhizobium leguminosarum cells on pea root hair tips. J. Bacteriol. 170, 2994-3000. Dazzo, F.B. and Hubbell, D.H. (1975) Cross-reactive antigens and lectin as determinants of symbiotic specificity in the Rhizobium-clover association. Appl. Microbiol. 30, 1017-1033. Bohlool, B.B. and Schmidt, E.L. (1974) Lectins: a possible basis for specificity in the Rhizobium-legume root nodule symbiosis. Science 185, 269-271. Halverson, L.J. and Stacey, G. (1985) Host recognition in the Rhizobium-soybean symbiosis. Plant Physiol. 77, 621-625. Diaz, C.L., Melchers, L.S., Hooykaas, P.J.J., Lugtenberg, B.J.J. and Kijne, J.W. (1989) Root lectin as a determinant of host-plant specificity in the Rhizobiumlegume symbiosis. Nature 338, 579-581. Ho, S.C., Ye, W., Schindler, M. and Wang, J.L. (1988) Quantitative assay for binding of Bradyrhizobium japonicurn to cultured soybean cells. J. Bacteriol. 170, 38823890. Ho, S.C., Schindler, M. and Wang, J.L. (1990) Carbohydrate binding activities of Bradyrhizobium japonicum. 1I. Isolation and characterization of a galactose-specific lectin. J. Cell Biol. 111, 1639-1643. Rostas, K., Kondorosi, E., Horvath, B., Simoncsits, A.
[63]
[64]
[65]
[66]
[67]
[68]
[69]
[70]
[71]
[72]
[73]
[74]
[75]
[76]
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
and Kondorosi, A. (1986) Conservation of extended promoter regions of nodulation genes in Rhizobium. Proc. Natl. Acad. Sci. USA 83, 1757-1761. Schofield, P.R. and Watson, J.M. (1986) DNA sequence of Rhizobiurn trifolii nodulation genes reveals a reiterated and potentially regulatory sequence preceding nodABC and nodFE. Nucleic Acids Res. 14, 2891-2903. Scott, K.F. (1986) Conserved nodulation genes from the non-legume symbiont Bradyrhizobium sp. (Parasponia). Nucleic Acids Res. 14, 2905-2919. Fisher, R.F., Egelhoff, T.T., Mulligan, J.T. and Long, S.R. (1988) Specific binding of proteins from Rhizobiurn meliloti cell-free extracts containing NodD to DNA sequences upstream of inducible nodulation genes. Genes Dev. 2, 282-293. Hong, G.F., Burn, J.E. and Johnston, A.W.B. (1987) Evidence that DNA involved in the expression of nodulation (nod) genes in Rhizobiurn binds to the product of the regulatory gene nodD. Nucleic Acids Res. 15, 96779690. Kondorosi, E., Gyuris, J., Schmidt, J., John, M., Duda, E., Hoffmann, B., Schell, J. and Kondorosi, A. (1989) Positive and negative control of nod gene expression in Rhizobiurn meliloti is required for optimal nodulation. EMBO J. 8, 1331-1340. Goethals, K., van Montagu, M. and Holsters, M. (1992) Conserved motifs in a divergent nod box of Azorhizobium caulinodans ORS571 reveal a common structure in promoters regulated by LysR-type proteins. Proc. Natl. Acad. Sci. USA 89, 1646-1650. Gy6rgypal, Z., Kiss, G.B. and Kondorosi, A. (1991) Transduction of plant signal molecules by the Rhizobium NodD proteins. BioEssays 13, 575-581. Winsor, B.A.T. (1989) A nod at differentiation: the nodD gene product and initiation of Rhizobium nodulation. Trends Genet. 5, 199-201. Mulligan, J.T. and Long, S.R. (1989) A family of activator genes regulates expression of Rhizobium meliloti nodulation genes. Genetics 122, 7-18. Barnett, M.J. and Long, S.R. (1990) DNA sequence and translational product of a new nodulation-regulatory locus: SyrM has sequence similarity to NodD proteins. J. Bacteriol. 172, 3695-3700. Kondorosi, E., Buir6, M., Cren, M., Iyer, N., Hoffmann, B. and Kondorosi, A. (1991) Involvement of the syrM and nodD3 genes of Rhizobiurn meliloti in nod gene activation and in optimal nodulation of the plant host. Mol. Microbiol. 5, 3035-3048. Downie, J.A., Knight, C.D., Johnston, A.W.B. and Rossen, L. (1985) Identification of genes and gene products involved in the nodulation of peas by Rhizobium leguminosarum. Mol. Gen. Genet. 198, 255-262. Goethals, K., den Eede, G.V., van Montagu, M. and Holsters, M. (1990) Identification and.characterization of a functional nodD gene in Azorhizobiurn caulinodans ORS571. J. Bacteriol. 172, 2658-2666. Innes, R.W., Kuempel, P.L., Plazinski, J., Canter-
57
[77]
[78]
[79]
[80]
[81]
[82]
[83]
[84]
[85]
[86]
[87]
[88]
[89]
Cremers, H., Rolfe, B.G. and Djordjevic, M.A. (1985) Plant factors induce expression of nodulation and hostrange genes in Rhizobium trifolii. Mol. Gen. Genet. 201, 426-432. G6ttfert, M., Horvath, B., Kondorosi, E., Putnoky, P., Rodriguez-Quifiones, F. and Kondorosi, A. (1986) At least two nodD genes are necessary for efficient nodulation of alfalfa by Rhizobium meliloti. J. Mol. Biol. 191, 411-420. Gy6rgypal, Z., Iyer, N. and Kondorosi, A. (1988) Three regulatory nodD alleles of diverged flavonoid-specificity are involved in host-dependent nodulation by Rhizobiurn meliloti. Mol. Gen. Genet. 212, 85-92. Honma, M.A. and Ausubel, F.M. (1987) Rhizobium rneliloti has three functional copies of the nodD symbiotic regulatory gene. Proc. Natl. Acad. Sci. USA 84, 8558-8562. Honma, M.A., Asomaning, M. and Ausubel, F.M. (1990) Rhizobium meliloti nodD genes mediate host-specific activation of nodABC. J. Bacteriol. 172, 901-911. Davis, E.O. and Johnston, A.W.B. (1990) Regulatory functions of the three nodD genes of Rhizobium leguminosarum biovar phaseoli. Mol. Microbiol. 4, 933-941. Davis, E.O. and Johnston, A.W.B. (1990) Analysis of three nodD genes in Rhizobium leguminosarum biovar phaseoli; nodD1 is preceded by nolE, a gene whose product is secreted from the cytoplasm. Mol. Microbiol. 4, 921-932. Appelbaum, E.R., Barkei, J., Kosslak, R., Johansen, E., Thompson, D. and Maroney, M. (1988) Regulation of nodABC expression in soybean rhizobia. In: Molecular Genetics of Plant-Microbe Interactions (Palacios, R. and Verma, D.P.S., Eds.), pp. 94-95. American Phytopathological Society Press, St. Paul, MN. Appelbaum, E.R., Thompson, D.V., Idler, K. and Chartrain, N. (1988) Rhizobium japonicum USDA191 has two nodD genes that differ in primary structure and function. J. Bacteriol. 170, 12-20. G6ttfert, M., Holzh/iuser, D., B/ini, D. and Hennecke. H. (1992) Structural and functional analysis of two different nodD genes in Bradyrhizobium japonicum USDA110. Mol. Plant-Microbe Interact., in press. Mulligan, J.T. and Long, S.R. (1985) Induction of Rhizobiurn meliloti nodC expression by plant exudate requires nodD. Proc. Natl. Acad. Sci. USA 82, 6609-6613. Rossen, L., Shearman, C.A., Johnston, A.W.B. and Downie, J.A. (1985) The nodD gene of Rhizobium legurninosarum is autoregulatory and in the presence of plant exudate induces the nodA, B, C genes. EMBO J. 4, 3369-3373. Shearman, C.A., Rossen, L., Johnston, A.W.B. and Downie, J.A. (1986) The Rhizobium leguminosarum nodulation gene nodF encodes a polypeptide similar to acyl-carrier protein and is regulated by nodD plus a factor in pea root exudate. EMBO J. 5, 647-652. Harborne, J.B. (1988) The Flavonoids: Advances in Research Since 1980. Chapman and Hall, London.
[90] Stafford. H.A. (1990) Flavonoid Metabolism. CRC Press. Boca Raton, FL. [91] Hartwig, U.A., Maxwell, C.A., Joseph. C.M. and Phillips, D.A. (1989) Interactions among flavonoid nod gene inducers released from alfalfa seeds and roots. Plant Physiol. 91. 1138-1142. [92] Recourt, K., Schripsema, J., Kijne, J.W., van Brussel, A.A.N. and Lugtenberg, B.J.J. (1991) Inoculation of 1/icia satil'a subsp, nigra roots with Rhizobiurn legurninosarum biovar uiciae results in release of nod gene activating flavanones and chalcones. Plant. Mol. Biol. 16, 841-852. [93] van Brussel, A.A.N., Recourt, K., Pees, E., Spaink, H.P., Tak, T., Wijffelman, C.A., Kijne, J.W. and Lugtenberg, B.J.J. (1990) A biovar-specific signal of Rhizobium leguminosarum bv. uiciae induces increased nodulation gene-inducing activity in root exudate of Vicia satiL'a subsp, nigra. J. Bacteriol. 172, 5394-5401. [94] Recourt, K., Verkerke, M., Schripsema, J., van Brussel, A.A.N., Lugtenberg, B.J.J. and Kijne, J.W. (1992) Major flavonoids in uninoculated and inoculated roots of Ficia satiua subsp, nigra are four conjugates of the nodulation gene-inhibitor kaempferol. Plant Mol. Biol. 18, 505-513. [95] Sutherland, T.D., Bassam, B.J., Schuller, L.J. and Gresshoff, P.M. (1990) Early nodulation signals of the wild type and symbiotic mutants of soybean (Glycine max). Mol. Plant-Microbe Interact. 3, 122-128. [96] Hartwig, U.A., Joseph, C.M. and Phillips, D.A. (1991) Flavonoids released naturally from alfalfa seeds enhance growth rate of Rhizobium meliloti. Plant Physiol. 95, 797-803. [97] Cunningham, S., Kollmeyer, W.D. and Stacey, G. (1991) Chemical control of interstrain competition for soybean nodulation by Bradyrhizobiurn japonicum. Appl. Environ. Microbiol. 57, 1886-1892. [98] Djordjevic, M.A., Redmond, J.W., Batley, M. and Rolfe, B.G. (1987) Clovers secrete specific phenolic compounds which either stimulate or repress nod gene expression in Rhizobiurn trifolii. EMBO J. 6, 1173-1179. [99] Firmin, J.L., Wilson, K.E., Rossen, W.L. and Johnston, A.W.B. (1986) Flavonoid activation of nodulation genes in Rhizobium reversed by other compounds present in plants. Nature 324, 90-92. [100] Kosslak, R.M., Joshi, R.S., Bowen, B.A., Paaren, H.E. and Appelbaum, E.R. (1990) Strain-specific inhibition of nod gene induction in Bradyrhizobiurn japonicurn by flavonoid compounds. Appl. Environ. Microbiol. 56, 1333-1341. [101] Peters, N.K. and Long, S.R. (1988) Alfalfa root exudates and compounds which promote or inhibit induction of Rhizobium meliloti nodulation genes. Plant Physiol. 88, 396-400. [102] Gy6rgypal, Z., Kondorosi, E. and Kondorosi, A. (1991) Diverse signal sensitivity of NodD protein homologs from narrow and broad host range rhizobia. Mol. Plant-Microbe Interact. 4, 356-364. [103] Hartwig, U.A., Maxwell, C.A., Joseph, C.M. and Phillips,
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
58
[104]
[105]
[106]
[107]
[108]
[109]
[110]
[111]
[112]
[113]
[114]
[115]
D.A. (1990) Effects of alfalfa nod gene-inducing flavonoids on nod,4BC transcription in Rhizobiurn meliloti strains containing different nodD genes. J. Bacteriol. 172, 2769-2773. Horvath, B., Bachem, C.W.B., Schell, J. and Kondorosi, A. (1987) Host-specific regulation of nodulation genes in Rhizobium is mediated by a plant-signal, interacting with the nodD gene product. EMBO J. 6, 841-848. Spaink, H.P., Wijffelman, C.A., Pees, E., Okker, R.J.H. and Lugtenberg, B.J.J. (1987) Rhizobium nodulation gene nodD as a determinant of host specificity. Nature 328, 337-340. Zaat, S.A.J., Wijffelman, C.A., Mulders, I.H.M., van Brussel, A.A.N. and Lugtenberg, B.J.J. (1988) Root exudates of various host plants of R. leguminosarum contain different sets of inducers of Rhizobium nodulation genes. Plant Physiol. 86, 1298-1303. Maxwell, C.A., Hartwig, U.A., Joseph, C.M. and Phillips, D.A. (1989) A chalcone and two related flavonoids released from alfalfa roots induce nod genes of Rhizobium meliloti. Plant Physiol. 91,842-847. Maillet, F., Debell6, F. and D6nari6, J. (1990) Role of the nodD and syrM genes in the activation of the regulatory gene nodD3, and of the common and hostspecific nod genes of Rhizobium meliloti. Mol. Microbiol. 4, 1975-1984. Recourt, K., van Brussel, A.A.N., Driessen, A.J.M. and Lugtenberg, B.J.J. (1989) Accumulation of a nod gene inducer, the flavonoid naringenin, in the cytoplasmic membrane of Rhizobium leguminosarum biovar t,iciae is caused by the pH-dependent hydrophobicity of naringenin. J. Bacteriol. 171, 4370-4377. Schlarnan, H.R.M., Spaink, H.P., Okker, R.J.H. and Lugtenberg, B.J.J. (1989) Subcellular localization of the nodD gene product in Rhizobium leguminosarum. J. Bacteriol. 171, 4686-4693. Burn, J., Rossen, L. and Johnston, A.W.B. (1987) Four classes of mutations in the nodD gene of Rhizobium legurninosarum biovar t'iciae that affect its ability to autoregulate a n d / o r activate other nod genes in the presence of flavonoid inducers. Genes Dev. 1,456-464. Burn, J.E., Hamilton, W.D., Wootton, J.C. and Johnston, A.W.B. (1989) Single and multiple mutations affecting properties of the regulatory gene nodD of Rhizobium. Mol. Microbiol. 3, 1567-1577. Mclver, J., Djordjevic, M.A., Weinman, J.J., Bender, G.L. and Rolfe, B.G. (1989) Extension of host range of Rhizobium legumino saturn bv. trifolii caused by point mutations in nodD that result in alterations in regulatory function and recognition of inducer molecules. Mol. Plant-Microbe Interact. 2, 97-106. Spaink, H.P., Wijffelman, C.A., Okker, R.J.H. and Lugtenberg, B.B.J. (1989) Localization of functional regions of the Rhizobium nodD product using hybrid nodD genes. Plant. Mol. Biol. 12, 59-73. Banfalvi, Z., Nieuwkoop, A., Schell, M., Besl, L. and Stacey, G. (1988) Regulation of nod gene expression in
Bradyrhizobium japonicum. Mol. Gen. Genet. 214, 420424. [116] Smitt, G., Puvanesarajah, V., Carlson, R.W., Barbour, W.M. and Stacey, G. (1992) Bradyrhizobiurn japonicum nodD1 can be specifically induced by soybean flavonoids that do not induce the nodYABCSUIJ operon. J. Biol. Chem. 267, 310-318. [117] Rushing, B.G., Yelton, M.M. and Long, S.R. (1991) Genetic and physical analysis of the nodD3 region of Rhizobium meliloti. Nucleic Acids Res. 19. 921-927. [118] Kondorosi, E., Pierre, M., Cren, M., Haumann, U., Buir6, M., Hoffmann, B., Schell, J. and Kondorosi, A. (1991) Identification of NolR, a negative transacting factor controlling the nod regulon in Rhizobium meliloti. J. Mol. Biol. 222, 885-896. [119] Dusha, I., Bakos, A., Kondorosi, A., de Bruijn, F.J. and Schell, J. (1989) The Rhizobium meliloti early nodulation genes (nodABC) are nitrogen-regulated: isolation of a mutant strain with efficient nodulation capacity on alfalfa in the presence of ammonium. Mol. Gen. Genet. 219, 89-96. [120] Wang, S.P. and Stacey, G. (1990) Ammonia regulation of nod genes in Bradyrhizobium japonicum. Mol. Gen. Genet. 223, 329-331. [121] Richardson, A., Simpson, R.J., Djordjevic, M.A. and Rolfe, B.G. (1988) Expression of nodulation genes in R. leguminosarum biovar trifolii is affected by low pH and by Ca and A1 ions. Appl. Environ. Microbiol. 54, 25412548. [122] Henikoff, S., Haughn, G.W., Cairo, J.M. and Wallace, J.C. (1988) A large family of bacterial activator proteins. Proc. Natl. Acad. Sci. USA 85, 6602-6606. [123] Schell, M.A. and Sukordhaman, M. (1989) Evidence that the transcription activator encoded by the Pseudomonas putida nahR gene is evolutionarily related to the transcription activators encoded by the Rhizobium nodD genes. J. Bacteriol. 171, 1952-1959. [124] You, I.S., Ghosal, D. and Gunsalus, I.C. (1988) Nucleotide sequence of plasmid NAH7 gene nahR and DNA binding of the nahR product. J. Bacteriol. 170, 5409-5415. [125] Long, S.R., Fisher, R.F., Ogawa, J., Swanson, J., Ehrhardt, D.W., Atkinson, E.M. and Schwedock, J.S. (1991) Rhizobium meliloti nodulation gene regulation and molecular signals. In: Advances in Molecular Genetics of Plant-Microbe Interactions (Hennecke, H. and Verma, D.P.S., Eds.), Vol. 1, pp. 127-133. Kluwer Academic Publishers, Dordrecht. [126] Wang, S.P. and Stacey, G. (1991) Studies of the Bradyrhizobium japonicum nodDl promoter: a repeated structure for the nod box. J. Bacteriol. 173, 3356-3365. [127] Fisher, R.F., Swanson, J.A., Mulligan, J.T. and Long, S.R. (1987) Extended region of nodulation genes in Rhizobium rneliloti 1021. II. Nucleotide sequence transcription start sites and protein products. Genetics 117, 191-201. [128] Fisher, R.F., Brierley, H.L., Mulligan, J.T. and Long,
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
59
[129]
[130]
[131]
[132]
[133]
[134]
[135]
[136]
[137]
[138]
[139]
[140]
[141]
S.R. (1987) Transcription of Rhizobium meliloti nodulation genes. J. Biol. Chem. 262, 6849-6855. Fisher, R.F. and Long, S.R. (1989) DNA footprint analysis of the transcriptional activator proteins NodDl and NodD3 on inducible nod gene promoters. J. Bacteriol. 171, 5492-5502. Schell, M.A., Brown, P.H. and Raju, S. (1990) Use of saturation mutagenesis to localize probable functional domains in the NahR protein, a LysR-type transcription activator. J. Biol. Chem. 265, 3844-3850. Miller, B.E. and Kredich, N.M. (1987) Purification of the cysB protein from Salmonella typhimurium. J. Biol. Chem. 262, 6006-6009. Schlaman, H.R.M., Okker, R.J.H. and Lugtenberg, B.J.J. (1990) Subcellular localization of the Rhizobium leguminosarum nodI gene product. J. Bacteriol. 172, 54865489. Schlaman, H.R.M., Horvath, B., Vijgenboom, E., Okker, R.J.H. and Lugtenberg, B.J.J. (1991) Suppression of nodulation gene expression in bacteroids of Rhizobium leguminosarum biovar viciae. J. Bacteriol. 173, 42774287. Sharma, S.B. and Signer, E.R. (1990) Temporal and spatial regulation of the symbiotic genes of Rhizobium meliloti in planta revealed by transposon Tn5-gusA. Genes Dev. 4, 344-356. Schmidt. J., John, M., Wieneke, U., Kdissmann, H.D. and Schell, J. (1986) Expression of the nodulation gene nod,4 in R. meliloti and localization of the gene product in the cytosol. Proc. Natl. Acad. Sci. USA 83, 9581-9585. John, M., Schmidt, J., Wieneke, U., Kriissmann, H.D. and Schell, J. (1988) Transmembrane orientation and receptor-like structure of the Rhizobium meliloti common nodulation protein NodC. EMBO J. 7, 583-588. Lerouge, P., Roche, P., Faucher, C., Maillet, F., Truchet, G., Prom6, J.C. and D~nari~:, J. (1990) Symbiotic hostspecificity of Rhizobium meliloti is determined by a sulphated and acylated glucosamine oligosaccharide signal. Nature 344, 781-784. Roche, P., Lerouge, P., Ponthus, C. and Prom~, J.C. (1991) Structural determination of bacterial nodulation factors involved in the Rhizobium meliloti-alfalfa symbiosis. J. Biol. Chem. 266, 10933-10940. Schultze, M., Quiclet-Sire, B., Kondorosi, E., Virelizier, H., Glushka, J.N., Endre, G., G6ro, S.D. and Kondorosi, A. (1992) Rhizobium meliloti produces a family of sulfated lipo-oligosaccharides exhibiting different degrees of plant host specificity. Proc. Natl. Acad. Sci. USA 89, 192-196. Spaink, H.P., Sheeley, D.M., van Brussel, A.A.N., Glushka, J., York, W.S., Tak, T., Geiger, O., Kennedy, E.P., Reinhold, V.N. and Lugtenberg, B.J.J. (1991) A novel highly unsaturated fatty acid moiety of lipo-oligosaccbaride signals determines host specificity of Rhizobium. Nature 354, 125-130. Spaink, H.P., Aarts, A., Stacey, G., Bloemberg, G.V.,
[142]
[143]
[144]
[145]
[146]
[147]
[148]
[149]
[150]
[151]
[152] [153]
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
Lugtenberg, B.J.J. and Kennedy, E.P. (1992) Detection and separation of Rhizobium and Bradyrhizobium nod metabolites using thin-layer chromatography. Mol. Plant-Microbe Interact. 5, 72-80. Broughton, W.J., Krause, A., Lewin, A., Perret. X., Price, N.P.J., Relic, B., Rochepeau, P., Wong, C.H., Pueppke, S.G. and Brenner, S. (1991) Signal exchange mediates host-specific nodulation of tropical legumes by the broad host-range Rhizobium species NGR234. In: Advances in Molecular Genetics of Plant-Microbe Interactions (Hennecke, H. and Verma, D.P.S., Eds.), Vol. 1, pp. 162-167. Kluwer Academic Publishers, Dordrecht. Truchet, G., Roche, P., Lerouge, P., Vasse, J., Camut, S., de Billy, F., Prom6, J.C. and D6nari6, J. (1991) Sulphated lipo-oligosaccharide signals of Rhizobium meliloti elicit root nodule organogenesis in alfalfa. Nature 351,670-673. Philip-Hollingsworth, S., Hollingsworth, R.I. and Dazzo, F.B. (1991) N-Acetylglutamic acid: an extracellular nod signal of Rhizobium trifolii ANU843 that induces root hair branching and nodule-like primordia in white clover roots. J. Biol. Chem. 266, 16854-16858. Djordjevic, M.A., Schofield, P.R., Ridge, R.W., Morrison, N.A., Bassam, B.J., Plazinski, J., Watson, J.M. and Rolfe, B.G. (1985) Rhizobium nodulation genes involved in root hair curling (Hac) are functionally conserved. Plant. Mol. Biol. 4, 147-160. Fisher, R.F., Tu, J.K. and Long, S.R. (1985) Conserved nodulation genes in Rhizobium meliloti and Rhizobium trifolii. Appl. Environ. Microbiol. 49, 1432-1435. Kondorosi, E., Banfalvi, Z. and Kondorosi, A. (1984) Physical and genetic analysis of a symbiotic region of Rht~.obium meliloti: identification of nodulation genes. Mol. Gen. Genet. 193, 445-452. Marvel, D.J., Kuldau, G., Hirsch, A., Richards, E., Torrey, J.G. and Ausubel, F.M. (1985)Conservation of nodulation genes between Rhizobium meliloti and a slow-growing Rhizobium strain that nodulates a nonlegume host. Proc. Natl. Acad. Sci. USA 82, 5841-5845. Schmidt. J., Wingender, R., John, M., Wieneke, U. and Schell, J. (1988) Rhizobium meliloti nodA and nodB genes are involved in generating compounds that stimulate mitosis of plant cells. Proc. Natl. Acad. Sci. USA 85, 8578-8582. Johnson, D., Roth, L.E. and Stacey, G. (1989) Immunogold localization of the NodC and NodA proteins of Rhizobium meliloti. J. Bacteriol. 171, 4583-4588. John, M., Schmidt, J., Wieneke, U., Kondorosi, E., Kondorosi, A. and Schell, J. (1985) Expression of the nodulation gene nodC of Rhizobium meliloti in Escherichia coli: role of the nodC gene product in nodulation. EMBO J. 4, 2425-2430. Bulawa, C.E. (1991) Chitin and nodulation. Nature 353, 710. Debell~, F. and Sharma, S.B. (1986) Nucleotide se-
60 quence of Rhizobium meliloti RCR2011 genes involved in host specificity of nodulation. Nucleic Acids Res. 14, 7453-7472. [154] Horvath, B., Kondorosi, E., John, M., Schmidt, J., Trrrk, I., Gyrrgypal, Z., Barabas, I., Wieneke, U., Schell, J. and Kondorosi, A. (1986) Organization, structure and symbiotic function of Rhizobium meliloti nodulation genes determining host specificity for alfalfa. Cell 46, 335-343. [155] Swanson, J.A., Tu, J.K., Ogawa, J., Sanga, R., Fisher, R.F. and Long, S.R. (1987) Extended region of nodulation genes in Rhizobium meliloti 1021. I. Phenotypes of Tn5 insertion mutants. Genetics 117, 181-189. [156] Geiger, O., Spaink, H.P. and Kennedy, E.P. (1991) Isolation of the Rhizobium legurninosarum NodF nodulation protein: NodF carries a 4'-phosphopantetheine prosthetic group. J. Bacteriol. 173, 2872-2878. [157] Spaink, H.P., Weinman, J., Djordjevic, M.A., Wijffelman, C.A., Okker, R.J.H. and Lugtenberg, B.J.J. (1989) Genetic analysis and cellular localization of the Rhizobium host specificity-determining NodE protein. EMBO J. 8, 2811-2818. [158] Bibb, M.J., Birr, S., Motamedi, H., Collins, J.F. and Hutchinson, C.R. (1989) Analysis of the nucleotide sequence of the Streptomyces glaucescens tcml genes provides key information about the enzymology of polyketide antibiotic biosynthesis. EMBO J. 8, 2727-2736. [159] Platt, M.W., Miller, K.J., Lane, W.S. and Kennedy, E.P. (1990) Isolation and characterization of the constitutive acyl carrier protein from Rhizobiurn meliloti. J. Bacteriol. 172, 5440-5444. [160] Sherman, D.H., Malpartida, F., Bibb, M.J., Kieser, H.M., Bibb, M.J. and Hopwood, D.A. (1989) Structure and deduced function of the granaticin-producing polyketide synthase gene cluster of Streptomyces L'iolaceoruber Tii22. EMBO J. 8, 2717-2725. [161] Baev, N. and Kondorosi, A. (1992) Nucleotide sequence of the Rhizobium rneliloti nodL gene located in locus n5 of the nod regulon. Plant Mol. Biol. 18, 843-846. [162] Canter Cremers, H.C.J., Spaink, H.P., Wijfjes, A.H.M., Pees, E., Wijffelman, C.A., Okker, R.J.H. and Lugtenberg, B.J.J. (1989) Additional nodulation genes on the Sym plasmid of Rhizobium leguminosarurn biovar t'iciae. Plant. Mol. Biol. 13, 163-174. [163] Surin, B.P. and Downie, J.A. (1988) Characterization of the Rhizobium leguminosarum genes nodLMN involved in efficient host-specific nodulation. Mol. Microbiol. 2, 173-183. [164] Downie, J.A. (1989) The nodL gene from Rhizobium leguminosarum is homologous to the acetyl transferases encoded by lacA and cysE. Mol. Microbiol. 3, 16491651. [165] Davis, E.O., Evans, I.J. and Johnston, A.W.B. (1988) Identification of nodX, a gene that allows Rhizobium legurninosarum biovar t'iciae strain TOM to nodulate Afghanistan peas. Mol. Gen. Genet. 212, 531-535. [166] Clark, C.A., Beltrame, J. and Manning, P.A. (1991) The
oac gene encoding a lipopolysaccharide O-antigen acetylase maps adjacent to the integrase-encoding gene on the genome of Shigella flexneri bacteriophage Sf6. Gene 107, 43-52. [167] Baev, N., Endre, G., Petrovics, G., Banfalvi, Z. and Kondorosi, A. (1991) Six nodulation genes of nod box locus 4 in Rhizobium meliloti are involved in nodulation signal production: nodM codes for D-glucosamine synthetase. Mol. Gen. Genet. 228, 113-124. [168] Marie, C., Barny, M.A. and Downie, J.A. (1992) Rhizobium leguminosarum has two glucosamine synthases, GImS and NodM, required for nodulation and development of nitrogen-fixing nodules. Mol. Microbiol. 6, 843851. [169] Lewis-Henderson, W.R. and Djordjevic, M.A. (1991) A cultivar-specific interaction between Rhizobium leguminosarurn bv. trifolii and subterranean clover is controlled by nodM, other bacterial cultivar specificity genes, and a single recessive host gene. J, Bacteriol. 173, 2791-2799. [170] Cervantes, E., Sharma, S.B., Maillet, F., Vasse, J , Truchet, G. and Rosenberg, C. (1989) The Rhizobium meliloti host range nodQ gene encodes a protein which shares homology with translation elongation and initiation factors. Mol. Microbiol. 3, 745-755. [171] Schwedock, J. and Long, S.R. (1989) Nucleotide sequence and protein products of two new nodulation genes of Rhizobium meliloti, nodP and nodQ. Mol. Plant-Microbe Interact. 2, 181-194. [172] Schwedock, J. and Long, S.R. (1990) ATP sulphurylase activity of the nodP and nodQ gene products of Rh/zobium rneliloti. Nature 348, 644-647. [173] Schmidt, J., John, M., Wieneke, U , Stacey, G., Rrhrig, H. and Schell, J. (1991) Studies on the function of Rhizobium meliloti nodulation genes. In: Advances in Molecular Genetics of Plant-Microbe Interactions (Hennecke, H. and Verma, D.P.S., Eds.), Vol. 1, pp. 150-155. Kluwer Academic Publishers, Dordrecht. [174] Roche, P., Debellr, F., Maillet, F., Lerouge, P., Faucher, C., Truchet, G., Drnarir, J. and Promr, J.C. (1991) Molecular basis of symbiotic host specificity in Rhizobium meliloti: nodH and nodPQ genes encode the sulfation of lipo-oligosaccharide signals. Cell 67, 1131-1143. [175] Evans, I.J. and Downie, J.A. (1986) The nodl gene product of Rhizobium leguminosarum is closely related to ATP-binding bacterial transport proteins; nucleotide sequence analysis of the nodl and nodJ genes. Gene 43, 95-101. [176] Grttfert, M., Hitz, S. and Hennecke, H. (1990) Identification of nodS and nodU, two inducible genes inserted between the Bradyrhizobium japonicum nodYABC and nodlJ genes. Mol. Plant-Microbe Interact. 3, 308-316. [177] Ames, G.F.L., Mimura, C.S. and Shyamala, V. (1990) Bacterial periplasmic permeases belong to a family of transport proteins operating from Escherichia coli to human: traffic ATPases. FEMS Microbiol. Rev. 75, 429-446.
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
61 [178] Higgins, C.F., Gallagher, M,P., Hyde, S.C., Mimmack, M.L. and Pearce, S.R. (1990) Periplasmic binding protein-dependent transport systems: the membrane-associated components. Phil. Trans. R. Soc. Lond. 326, 353365. [179] Busch, S.J. and Sassone-Corsi, P. (1990) Dimers, leucine zippers and DNA-binding domains. Trends Genet. 6, 36-40. [180] Gentschev, I. and Goebel, W. (1992) Topological and functional studies on HIyB of Escherichia coll. Mol. Gen. Genet. 232, 40-48. [181] Juranka, P., Zhang, F., Kulpa, J., Endicott, J., Blight, M.. Holland, I.B. and Ling, V. (1992) Characterization of the hemolysin transporter, HlyB, using an epitope insertion. J. Biol. Chem. 267, 3764-3770. [182] Nies, D.H., Nies, A., Chu, L. and Silver, S. (1989) Expression and nucleotide sequence of a plasmid-determined divalent cation efflux system from Alcaligenes eutrophus. Proc. Natl. Acad. Sci. USA 86, 7351-7355. [183] Lewis-Henderson, W.R. and Djordjevic, M.A. (1991) NodT, a positively-acting cultivar specificity determinant controlling nodulation of Trifolium subterraneum by Rhizobium leguminosarum biovar trifolii. Plant Mol. Biol. 16, 515-526. [184] Surin, B.P., Watson, J.M., Hamilton, W.D.O., Economou, A. and Downie, J.A. (1990) Molecular characterization of the nodulation gene, nodT, from two biovars of Rhizobium leguminosarum. Mol. Microbiol. 4, 245-252. [185] de Maagd, R.A., Wijffelman, C.A., Pees, E. and Lugtenberg, B.J.J. (1988) Detection and subcellular localization of two Sym plasmid-dependent proteins of Rhizobium leguminosarum biovar ciciae. J. Bacteriol. 170, 44244427. [186] de Maagd, R.A., Wijfjes, A.H.M., Spaink, H.P., RuizSainz, J.E., Wijffeiman, C.A., Okker, R.J.H. and Lugtenberg, B.J.J. (1989) nodO, a new nod gene of the Rhizobium leguminosarum biovar viciae Sym plasmid pRL1JI, encodes a secreted protein. J. Bacteriol. 171, 6764-6770. [187] Economou, A., Hamilton, W.D.O., Johnston, A.W.B. and Downie, J.A. (1990) The Rhizobium nodulation gene nodO encodes a Ca2+-binding protein that is exported without N-terminal cleavage and is homologous to haemolysin and related proteins. EMBO J. 9, 349354. [188] Scheu, A.K., Economou, A., Hong, G.F., Ghelani, S., Johnston, A.W.B. and Downie, J.A. (1992) Secretion of the Rhizobium leguminosarum nodulation protein NodO by haemolysin-type systems. Mol. Microbiol. 6, 231-238. [189] de Maagd, R.A., Spaink, H.P., Pees, E., Mulders, I.H.M.. Wijfjes, A., Wijffelman, C.A., Okker, R.J.H. and Lugtenberg, B.J.J. (1989) Localization and symbiotic function of a region on the Rhizobium legurninosarum Sym plasmid pRLIJI responsible for a secreted, flavonoid-inducible 50-kilodalton protein. J. Bacteriol. 171, 1151-1157.
[190] Downie, J.A. and Surin, B.P. (1990) Either of two nod gene loci can complement the nodulation defect of a nod deletion mutant of Rhizobium leguminosarum by. t,iciae. Mol. Gen. Genet. 222, 81-86. [191] Djordjevic, M.A. and Weinman, J.J. (1991) Factors determining host recognition in the clover-Rhizobium symbiosis. Aust. J. Plant Physiol. 18, 543-557. [192] Lewin, A., Cervantes, E., Chee-Hoong, W. and Broughton, W.J. (1990) nodSU, two new nod genes of the broad host range Rhizobium strain NGR234 encode host-specific nodulation of the tropical tree Leucaena leucocephala. Mol. Plant-Microbe Interact. 3, 317-326. [193] Nieuwkoop, A.J., Banfalvi, Z., Deshmane, N., Gerhold, D., ScheU, M.G., Sirotkin, K.M. and Stacey, G. (1987) A locus encoding host range is linked to the common nodulation genes of Bradyrhizobium japonicum. J. Bacteriol. 169, 2631-2638. [194] G6ttfert, M., Lamb, J.W., Gasser, R., Semenza, J. and Hennecke, H. (1989) Mutational analysis of the Bradyrhizobium japonicum common nod genes and further nod box-linked genomic DNA regions. Mol. Gen. Genet. 215, 407-415. [195] Sadowsky, M.J., Cregan, P.B., G6ttfert, M., Sharma, A., Gerhold, D., Rodriguez-Quifiones, F., Keyser, H.H., Hennecke, H. and Stacey, G. (1991) The Bradyrhizobium japonicum nolA gene and its involvement in the genotype-specific nodulation of soybeans. Proc. Natl. Acad. Sci. USA 88, 637-641. [196] Krishnan, H.B. and Pueppke, S.G. (1991) noIC, a Rhizobium fredii gene involved in cultivar-specific nodulation of soybean, shares homology with a heat-shock gene. Mol. Microbiol. 5, 737-745. [197] Krishnan, H.B. and Pueppke, S.G. (1992) Inactivation of noIC conditions developmental abnormalities in nodulation of Peking soybean by Rhizobium fredii USDA257. Mol. Plant-Microbe Interact. 5, 14-21. [198] G6ttfert, M., Grob, P. and Hennecke, H. (1990) Proposed regulatory pathway encoded by the nodF and nodW genes, determinants of host specificity in Bradyrhizobium japonicum. Proc. Natl. Acad. Sci. USA 87, 2680-2684. [199] Deshmane, N. and Stacey, G, (1989) Identification of Bradyrhizobium nod genes involved in host-specific nodulation. J. Bacteriol. 171, 3324-3330. [200] Cervantes, E., van Slooten, J.C. and Stanley, J. (1990) Rhizobium sp. NGR234: molecular microbial ecology and multiple symbiosis. Symbiosis 8, 251-270. [201] Broughton, W.J,, Wong, C.H., Lewin, A., Samrey, U., Myint, H., Meyer, H., Dowling, D.N. and Simon, R. (1986) Identification of Rhizobium plasmid sequences involved in recognition of Psophocarpus, 14gna, and other legumes. J. Cell Biol. 102, 1173-1182. [202] Nayudu, M. and Rolfe, B.G. (1987) Analysis of R-primes demonstrates that genes for broad host range nodulafinn of Rhizobium strain NGR234 are dispersed on the Sym plasmid. Mol. Gen. Genet. 206, 326-337. [203] Perret, X., Broughton, W.J. and Brenner, S. (1991)
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
62 Canonical ordered cosmid library of the symbiotic plasmid of Rhizobium species NGR234. Proc. Natl. Acad. Sci. USA 88, 1923-1927. [204] Lewin, A., Rosenberg, C., Meyer, H., Wong, C.H., Nelson, L., Manen, J.-F., Stanley, J., Dowling, D.N., D~nari6, J. and Broughton, W.J. (1987) Multiple hostspecificity loci of the broad host-range Rhizobium sp. NGR234 selected using the widely compatible legume Vigna unguiculata. Plant. Mol. Biol. 8, 447-459. [205J Putnoky, P. and Kondorosi, A. (1986) Two gene clusters of Rhizobium meliloti code for early essential nodulation functions and a third influences nodulation efficiency. J. Bacteriol. 167, 881-887. [206] Innes, R.W., Hirose, M.A. and Kuempel, P.L. (1988) Induction of nitrogen-fixing nodules on clover requires only 32 kilobase pairs of DNA from the Rhizobium trifolii symbiosis plasmid. J. Bacteriol. 170, 3793-3802. [207} Spaink, H.P., Okker, R.J.H., Wijffelman, C.A., Tak, T., Goosen-de Roo, L., Pees, E., van Brussel, A.A.N. and Lugtenberg, B.J.J. (1989) Symbiotic properties of rhizobia containing a flavonoid-independent hybrid nodD product. J. Bacteriol. 171, 4045-4053. [208] Faucher, C., Maillet, F,, Vasse, J., Rosenberg, C., van Brussel, A.A.N., Truchet, G. and Ddnarid, J, (1988) Rhizobium meliloti host range nodH gene determines production of an alfalfa-specific extracellular signal. J. Bacteriol. 170, 5489-5499. [209] Debell6, F., Maillet, F., Vasse, J., Rosenberg, C., de Billy, F., Truchet, G., Ddnarid, J. and Ausubel, F.M. (1988) Interference between Rhizobium meliloti and Rhizobium trifolii nodulation genes: genetic basis of R meliloti dominance. J. Bacteriol. 170, 5718-5727. [210] Faucher, C., Camut, S., Ddnari~, J. and Truchet, G. (1989) The nodH and nodQ host range genes of Rhizobium meliloti behave as avirulence genes in R. leguminosarum by. ciciae and determine changes in the production of plant-specific extracellular signals. Mol. Plant-Microbe Interact. 2, 291-300. [211] Djordjevic, M.A., Innes, R.W., Wijffelman, C.A., Schofield, P.R. and Rolfe, B.G. (1986) Nodulation of specific legumes is controlled by several distinct loci in Rhizobium trifolii. Plant Mol. Biol. 6, 389-401. [212] Surin, B.P. and Downie, J.A. (1989) Rhizobium leguminosarum genes required for expression and transfer of host specific nodulation. Plant Mol. Biol. 12, 19-29. [213] Farmer, E.E., Moloshok, T.D., Saxton, M.J. and Ryan, C.A. (1991) Oligosaccharide signaling in plants. J. Biol. Chem. 266, 3140-3145. [214] Ryan, C.A. (1987) Oligosaccharide signalling in plants. Annu. Rev. Cell Biol. 3, 295-317. [215] Rosa, F., Sargent, T.D., Rebbert, M.L., Michaels, G.S., Jamrich, M., Grunz, H., Jonas, E., Winkles, J.A. and Dawid, I.B. (1988) Accumulation and decay of DG42 gene products follow a gradient pattern during Xenopus embryogenesis. Dev. Biol. 129, 114-123. [216] Kobayashi, D.Y., Tamaki, S.J. and Keen, N.T. (1990) Molecular characterization of avirulence gene D from
Pseudomonas syringae pv. tomato. Mol. Plant-Microbe Interact. 3, 94-102. [217] Dreyfus, B., Garcia, J.L. and Gillis, M. (1988) Characterization of Azorhizobium caulinodans gen. nov., sp. nov., a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata. Int. J. Syst. Bacteriol. 38, 89-98. [218] Jordan, D.C. (1982) Transfer of Rhizobium japonicum Buchanan 1980 to Bradyrhizobium gen. nov., a genus of slow-growing, root nodule bacteria from leguminous plants. Int. J. Syst. Bacteriol. 32, 136-139. [219] Baldwin, I.L. and Fred, E.B. (1929) Nomenclature of the root-nodule bacteria of the Leguminosae. J. Bacteriol. 17, 141-150. [220] Scholla, M.H. and Elkan, G.H. (1984) Rhizobium fredii sp. nov., a fast-growing species that effectively nodulates soybeans. Int. J. Syst. Bacteriol. 34, 484-486. [221] Keyser, H.H., Bohlool, B.B., Hu, T.S. and Weber, D.F. (1982) Fast-growing rhizobia isolated from root nodules of soybean. Science 215, 1631-1632. [222] Lindstr6m, K. (1989) Rhizobium galegae, a new species of legume root nodule bacteria. Int. J. Syst. Bacteriol. 39, 365-367. [223] Jordan, D.C. (1984) Family III. Rhizobiaceae Corm 1938, 321. In: Bergey's Manual of Systematic Bacteriology (Krieg, N.R. and Holt, J.G., Eds.), pp. 234-244. Williams & Wilkins, Baltimore, MD. [224] Jarvis, B.D.W., Pankhurst, C.E. and Patel, J.J. (1982) Rhizobium loft, a new species of legume root nodule bacteria. Int. J. Syst. Bacteriol. 32, 378-380. [225] Martfnez-Romero, E., Segovia, L., Mercante, F.M., Franco, A.A., Graham, P. and Pardo, M.A. (1991) Rhizobium tropici, a novel species nodulating Phaseolus culgaris L. beans and Leucaena sp. trees. Int. J. Syst. Bacteriol. 41,417-426. [226} Trinick, M,J. (1980) Relationships amongst the fastgrowing rhizobia of Lablab purpureus, Leucaena leucocephala, Mimosa spp., Acacia farnesiana and Sesbania grandiflora and their affinities with other rhizobial groups. J. Appl. Bacteriol. 49, 39-53. [227] Pankhurst, C.E., Broughton, W.J., Bachem, C., Kondorosi, E. and Kondorosi, A. (1983) Identification of nitrogen fixation and nodulation genes on a large plasmid from a broad host range Rhizobium sp. In: Molecular Genetics of the Bacteria-Plant Interaction (Piihler, A., Ed.), pp. 169-176. Springer-Verlag, Berlin. [228] Goethals, K., Gap, M., Tomekpe, K., van Montagu, M. and Holsters, M. (1989) Common nodABC genes in nod locus 1 of Azorhizobium caufinodans: nucleotide sequence and plant-inducible expression. Mol. Gen. Genet. 219, 289-298. [229] Lamb, J.W. and Hennecke, H. (1986) In Bradyrhizobium japonicum the common nodulation genes, nodABC, are linked to nifA and .Ftr..4. Mol. Gen. Genet. 202, 512-517. [230] Krishnan, H.B. and Pueppke, S.G. (1991) Sequence and analysis of the nodABC region of Rhizobium fredii
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018
63
[231]
[232]
[233]
I234]
[235]
[236]
[237]
[238]
[239]
[240]
[241]
USDA2.57, a nitrogen-fixing symbiont of soybean and other legumes. Mol. Plant-Microbe Interact. 4, 512-520. R~is~inen, L.A., Heikkil~i-Kallio, U., Suominen, L. and Lindstr6m, K. (1991) Expression of Rh&obium galegae common nod clones in various backgrounds. Mol. Plant-Microbe Interact. 4, 535-544. Rossen, L., Johnston, A.W.B. and Downie, J.A. (1984) DNA sequence of the Rhizobium leguminosarum nodulation genes nodAB and C required for root hair curling. Nucleic Acids Res. 12, 9497-9508. Vargas, C., Martinez, L.J., Megias, M. and Quinto, C. (1990) Identification and cloning of nodulation genes and host specificity determinants of the broad host-range Rhizobium leguminosarurn biovar phaseoli strain CIAT899. Mol. Microbiol. 4, 1899-1910. V~zquez, M., Davalos, A., de las Pe~as, A., S~nchez, F. and Quinto, C. (1991) Novel organization of the common nodulation genes in Rhizobium legurninosarum bv. phaseoli strains. J. Bacteriol. 173, 1250-1258. Collins-Emerson, J.M., Terzaghi, E.A. and Scott, D.B. (1990) Nucleotide sequence of Rhizobium loti nodC. Nucleic Acids Res. 18, 6690. Egelhoff, T.T., Fisher, R.F., Jacobs, T.W., Mulligan, J.T. and Long, S.R. (1985) Nucleotide sequence of Rhizobium meliloti 1021 nodulation genes: nodD is read divergently from nod,4BC. DNA 4, 241-248. T6r6k, I., Kondorosi, E., Stepkowski, T , P6sfai, J: and Kondorosi, A. (1984) Nucleotide sequence of Rhizobium meliloti nodulation genes. Nucleic Acids Res. 12, 95099523. Bachem, C.W.B., Kondorosi, E., Banfalvi, Z., Horvath, B., Kondorosi, A. and Schell, J. (1985) Identification and cloning of nodulation genes from the wide host range Rhizobium strain MPIK3030. Mol. Gen. Genet. 199, 271-278. Scott, B., MacDonald, P., Young, C. and Pankhurst, C. (1988) Rhizobium loti host-specific nodulation genes. In: Molecular Genetics of Plant-Microbe Interactions (Palacios, R. and Verma, D.P.S., Eds.), pp. 105-106. APS Press, St. Paul, MN. Jacobs, T.W., Egelhoff, T.T. and Long, S.R. (1985) Physical and genetic map of a Rhizobium meliloti nodulation gene region and nucleotide sequence of nodC. J. Bacteriol. 162, 469-476. Young, C., Collins-Emerson, J.M., Terzaghi, E.A. and Scott, D.B. (1990) Nucleotide sequence of Rhizobium loti nodl. Nucleic Acids Res. 18, 6691.
[242] G6tz, R., Evans, l.J., Downie. J.A. and Johnston, A.W.B. (1985) Identification of the host-range DNA which "~llows Rhizobium legurninosarum strain TOM to nodulate cv. Afghanistan peas. Mol. Gen. Genet. 20l, 296-300. [243] Kosslak, R.M., Bookland, R., Barkei, J., Paaren, H.E. and Appelbaum. E.R. (1987) Induction of Bradyrhizobium japonicum common nod genes by isoflavones isolated from Glycine max. Proc. Natl. Acad. Sci. USA 84, 7428-7432. [244] Bassam, B.J., Djordjevic, M.A., Redmond, J.W., Batley, M. and Rolfe, B.G. (1988) Identification of a nodD-dependent locus in the Rhizobium strain NGR234 activated by phenolic factors secreted by soybeans and other legumes. Mol. Plant-Microbe Interact. 1, 161-168. [245] Redmond, J.W., Barley, M., Djordjevic, M.A., lnnes, R.W., Kuempel, P.L. and Rolfe, B.G. (1986) Flavones induce expression of nodulation genes in Rhizobium. Nature 323, 632-635. [246] Hartwig, U.A., Maxwell, C.A., Joseph, C.M. and Phillips, D.A. (1990) Chrysoeriol and luteolin released from alfalfa seeds induce nod genes in Rhizobium meliloti. Plant Physiol. 92, 116-122. [247] Hungria, M., Joseph, C.M. and Phillips, D.A. (1991) Anthocyanidins and flavonols, major nod gene inducers from seeds of a black-seeded common bean (Phaseolus t'ulgaris L.). Plant Physiol. 97, 751-758. [248] Messens, E., Geelen, D., van Montagu, M. and Holsters, M. (1991) 7,4'-Dihydroxyflavanone is the major Azorhizobium nod gene-inducing factor present in Sesbahia rostrata seedling exudate. Mol. Plant-Microbe Interact. 4, 262-267. [249] Hungria, M., Joseph, C.M. and Phillips, D.A. (1991) Rhizobium nod gene inducers exuded naturally from roots of common bean (Phaseolus t'ulgaris L.). Plant Physiol. 97, 759-764. [250] Zaat, S.A.J., Schripsema, J., Wijffelman, C.A., van BrusseL A.A.N, and Lugtenberg, B.J.J. (1989) Analysis of the major inducers of the Rhizobium nodA promoter from Vicia satit,a root exudate and their activity with different nodD genes. Plant. Mol. Biol. 13, 175-188. [251] G6ttfert, M., Weber, J. and Hennecke, H. (1988) Induction of a nodA-lacZ fusion in Bradyrhizobium japonicum by an isoflavone. J. Plant Physiol. 132, 394-397. [252} Spaink, H.P., Okker, R.J.H., Wijffelman, C.A., Pees, E. and Lugtenberg, B.J.J. (1987) Promoters in the nodulation region of the Rhizobium leguminosarum Sym plasmid pRL1JI. Plant. Mol. Biol. 9, 27-39.
Downloaded from https://academic.oup.com/femsre/article-abstract/10/1-2/39/527856 by guest on 22 February 2018