RESEARCH ARTICLE 1925
Development 138, 1925-1934 (2011) doi:10.1242/dev.060020 © 2011. Published by The Company of Biologists Ltd
Regulation of mammalian Notch signaling and embryonic development by the protein O-glucosyltransferase Rumi Rodrigo Fernandez-Valdivia1, Hideyuki Takeuchi2, Amin Samarghandi1, Mario Lopez1, Jessica Leonardi3, Robert S. Haltiwanger2 and Hamed Jafar-Nejad1,3,4,5,6,*
SUMMARY Protein O-glucosylation is a conserved post-translational modification that occurs on epidermal growth factor-like (EGF) repeats harboring the C1-X-S-X-P-C2 consensus sequence. The Drosophila protein O-glucosyltransferase (Poglut) Rumi regulates Notch signaling, but the contribution of protein O-glucosylation to mammalian Notch signaling and embryonic development is not known. Here, we show that mouse Rumi encodes a Poglut, and that Rumi–/– mouse embryos die before embryonic day 9.5 with posterior axis truncation and severe defects in neural tube development, somitogenesis, cardiogenesis and vascular remodeling. Rumi knockdown in mouse cell lines results in cellular and molecular phenotypes of loss of Notch signaling without affecting Notch ligand binding. Biochemical, cell culture and cross-species transgenic experiments indicate that a decrease in Rumi levels results in reduced O-glucosylation of Notch EGF repeats, and that the enzymatic activity of Rumi is key to its regulatory role in the Notch pathway. Genetic interaction studies show that removing one copy of Rumi in a Jag1+/– (jagged 1) background results in severe bile duct morphogenesis defects. Altogether, our data indicate that addition of O-glucose to EGF repeats is essential for mouse embryonic development and Notch signaling, and that Jag1-induced signaling is sensitive to the gene dosage of the protein O-glucosyltransferase Rumi. Given that Rumi–/– embryos show more severe phenotypes compared to those displayed by other global regulators of canonical Notch signaling, Rumi is likely to have additional important targets during mammalian development.
INTRODUCTION Notch signaling is one of the pathways widely used during animal development and in the adult maintenance of a variety of tissues and cell types (Fortini, 2009; Kopan and Ilagan, 2009). Mutations in several components of this pathway play causative roles in various diseases (Ellisen et al., 1991; Joutel et al., 1996; Bulman et al., 2000; Eldadah et al., 2001; Garg et al., 2005; Lee et al., 2009), including a multisystem developmental disorder called the Alagille syndrome (Li et al., 1997; Oda et al., 1997). The Notch proteins and their ligands are type I transmembrane proteins with a number of epidermal growth factor-like (EGF) repeats in their extracellular domain. EGF repeats usually consist of ~40 amino acids, including six cysteine residues that form three disulfide bonds to generate the three-dimensional structure of the EGF repeat (Harris and Spellman, 1993). Several forms of O-linked carbohydrates decorate the EGF repeats of Drosophila and mammalian Notch proteins
1
Brown Foundation Institute of Molecular Medicine (IMM), The University of Texas Health Science Center, Houston, TX 77030, USA. 2Department of Biochemistry and Cell Biology, Institute for Cell and Developmental Biology, Stony Brook University, Stony Brook, NY 11794, USA. 3Program in Developmental Biology, Baylor College of Medicine, Houston, TX 77030, USA. 4Department of Biochemistry and Molecular Biology, Medical School, The University of Texas Health Science Center, Houston, TX 77030, USA. 5Program in Genes and Development, The University of Texas Graduate School of Biomedical Sciences, Houston, TX 77030, USA. 6Program in Biochemistry and Molecular Biology, The University of Texas Graduate School of Biomedical Sciences, Houston, TX 77030, USA. *Author for correspondence (
[email protected]) Accepted 18 February 2011
(Moloney et al., 2000; Matsuura et al., 2008): O-fucose, O-GlcNAc (N-acetylglucosamine) and O-glucose. Loss of the enzyme responsible for the addition of O-fucose to Notch (protein Ofucosyltransferase 1) results in embryonic lethality, with phenotypes similar to a global loss of Notch signaling in flies and in mice (Okajima and Irvine, 2002; Sasamura et al., 2003; Shi and Stanley, 2003). Therefore, Notch signaling seems to be the primary biologically relevant target of Ofut1/Pofut1 during embryonic development. O-glucosylation occurs on Notch and other proteins with EGF repeats harboring a C1-X-S-X-P-C2 consensus motif, where S is the glucosylated serine and C1 and C2 are the first and second cysteine residues in the target EGF repeat (Hase et al., 1988; Harris and Spellman, 1993). Vertebrate and Drosophila Notch proteins harbor the largest number of EGF repeats with predicted O-glucosylation motifs, although other proteins, including Notch ligands and several coagulation factors, also contain a number of such motifs (Moloney et al., 2000). Mutations in Drosophila rumi, which encodes the fly protein O-glucosyltransferase, result in a temperature-sensitive loss of Notch signaling (Acar et al., 2008). Moreover, RNAi-mediated knockdown of Rumi in Drosophila S2 cells causes a severe reduction in the level of O-glucose on Notch EGF repeats. These observations established an important role for protein O-glucosylation in the regulation of Drosophila Notch signaling (Acar et al., 2008). The glycosyltransferase activity of fly Rumi is mediated by the CAP10 domain, which is named after the cryptococcal protein CAP10 (Chang and Kwon-Chung, 1999). To examine whether the role of Rumi in the regulation of Notch signaling is conserved
DEVELOPMENT
KEY WORDS: Notch signaling, O-glucosylation, Mouse, Jag1, EGF repeat, Drosophila
1926 RESEARCH ARTICLE
between flies and mammals, we initiated genetic, cell culture and biochemical studies on mouse genes encoding CAP10-containing proteins and found that only one of these homologs, mouse Rumi, has Poglut activity. Our data indicate that Rumi is required for embryonic development and Notch signaling in the mouse. Our data further suggest that Jag1-induced Notch signaling is sensitive to the gene dosage of mouse Rumi. MATERIALS AND METHODS Generation of the Rumi mutant mouse
The IST10323G11 (Texas A&M Institute for Genomic Medicine) (Hansen et al., 2008) heterozygous C57BL/6N ES cell clone with a gene trap insertion in intron 2 of Rumi was used to generate the Rumi mutant mouse (official name: Poglut1GT(IST10323G11)TIGM). For Southern blot analysis, genomic DNA was digested with AvrII, BglII or HindIII, and the blots were hybridized with a probe against the neomycin resistance gene (FernandezValdivia et al., 2010). All mice were housed in temperature-controlled (22±2°C) rooms, with 12 hour light, 12 hour dark photocycle, and fed with rodent chow meal and fresh water, ad libitum. All surgical procedures as well as euthanasia protocols were approved by the Animal Welfare Committee of The University of Texas Health Science Center at Houston, and were in accordance with the procedures outlined in the ‘Guide for the Care and Use of Laboratory Animals’ (NIH publication 85-23).
Development 138 (10) Actin-HRP (1:2000, Santa Cruz Biotechnology), anti--Actin (1:2000, Abcam) and anti-cleaved Notch1 (Val1744, 1:1000, Cell Signaling Technology). Biotinylation assays were performed as described previously (Mumm et al., 2000; Rampal et al., 2005) using the anti-Notch1 Na polyclonal antibody (Lu and Lux, 1996). Flow cytometry
Flow cytometry was performed on a BD FACS Aria II according to published protocols with slight modifications (Yang et al., 2005; Stahl et al., 2008). Purified rat Dll1-human Fc (1 g/ml), rat Jag1-human Fc (0.5 g/ml) (Hicks et al., 2000) and human Fc (1 g/ml) were preclustered with R-PE conjugated anti-human Fc for 1 hour at 4°C. The following antibodies were used: anti-Notch1 (10 g/ml, R&D Systems); R-PEconjugated F(ab’)2 anti-sheep IgG (1:100), sheep IgG (10 g/ml), human Fc fragment (1 g/ml) and R-PE-conjugated F(ab’)2 anti-human Fc fragment (1:100) from Jackson ImmunoResearch Laboratories. Differentiation assays on Neuro2A cells
Neuro2A differentiation assays were performed as described previously (Franklin et al., 1999) with some modifications. At least three independent experiments were performed for each cell line/transfection. In each experiment, five independent fields of ~100 cells were used for quantification of the neurite extension per cell line/transfection. Transgenic fly experiments
Genomic DNA from tail tips, yolk sacs or ES cells was used for PCR genotyping. Paraformaldehyde-fixed early embryos were directly genotyped after immunohistochemical experiments. For primers, see Table S1 in the supplementary material. Embryonic studies
Embryos were collected between E7.5 and E10.5. E8.0 embryos were fixed in 4% PFA in PBS, washed with PBS and pre-embedded in 1% low melting point agarose in PBS. Agarose blocks were dehydrated with alcohol series, cleared with xylenes and embedded in paraffin blocks. Embryo blocks were sectioned at 5 m, and the sections stained with Hematoxylin and Eosin. DBA lectin histochemistry and immunohistochemistry
DBA lectin histochemistry and Pecam1 staining were performed as described previously (McCright et al., 2002; Kuhnert et al., 2005). For Rumi staining, antigen was retrieved in a boiling solution of 10 mM sodium citrate (pH 6.0) for 20 minutes. The anti-Rumi antibody was raised in rabbits against the peptide RQKDSGSKWKVFLD (see Fig. S2 in the supplementary material). Anti-Rumi and Cy3-conjugated goat anti-Rabbit secondary (Jackson ImmunoResearch Laboratories) antibodies were used at 1:250. RT-PCR and qRT-PCR analysis
Total RNA was extracted using QIAzol and RNeasy kit (Qiagen). qRTPCR was performed using 100 ng total RNA per well and TaqMan OneStep RT-PCR Master Mix (Applied Biosystems). Relative mRNA levels were compared using the 2–DDCT method, with 18S as control. For Hes1 qRT-PCR in Neuro2A cells, 2 g of total RNA per well were used. For RTPCR, 1 g of total RNA per lane was used to synthesize cDNA. For primers and primers/probe sets see Table S1 in the supplementary material. Cell culture, Rumi knockdown, immunoblots and biotinylation assays
NMuLi, HepG2, BNL-CL2, Neuro2A, HEK293T and C2C12 cells were cultured in DMEM (Thermo Fisher) supplemented with 10% FBS (Thermo Fisher). Transfections were performed in OPTI-MEM (Invitrogen), using either Fugene HD (Roche) or Lipofectamine 2000 (Invitrogen). pLKO.1 plasmids (Moffat et al., 2006) encoding shRNA-30 against mouse Rumi and non-target control shRNA-NT (Sigma) were used to generate stably transfected cells. Plasmids used for transient transfection include: mouse Rumi cDNA (pcDNA4-mRumi); EGFP-C2 (Clontech); pTracer; pTracerhRumi-FLAG; and pTracer-hRumi-FLAG-G169E mutant. Antibodies used in western blots are anti-mouse Rumi (1:500, this study), anti-a-Tubulin (1:2000, Santa Cruz Biotechnology), anti-GFP (1:4000, Abcam), anti--
The ORF of the rat Jag1 was cloned into the pUAST-attB vector and integrated into the fly genome as described (Venken et al., 2006; Bischof et al., 2007). UAS-ratDLL1-HA, UAS-mDLL3-FLAG (Geffers et al., 2007) and UAS-attB-ratJagged1 (this study) were used to overexpress mammalian ligands in mitotic clones of the null allele rumiD26 (Acar et al., 2008) or in mitotic clones of a wild-type chromosome (control) by using the MARCM technique (Lee and Luo, 2001) as described previously (Acar et al., 2008). Wing imaginal discs were dissected and fixed by using standard protocols and stained with a-Jag1 (1:100, Santa Cruz Biotechnology), a-Cut (1:500, DSHB) and/or a-FLAG (1:500, Sigma) antibodies. Enzymatic assays
Cells and livers were homogenized in approximately 5 volumes of TBSComplete, and incubated on ice for 60 minutes. After centrifugation, the supernatants were used as protein extracts. Enzymatic assays for hRumiFLAG and hRumi-G169E-FLAG were performed on cell lysates from transiently transfected HEK293T cells. Both O-glucosyltransferase and Ofucosyltransferase 1 assays were performed as previously described (Shao et al., 2002) with slight modifications. Mass spectrometric analysis
A cDNA encoding a region of the extracellular domain of mouse Notch2 encompassing EGF repeats 13-18 (amino acids 468-699) was inserted into pSecTag2/Hygro C vector (Invitrogen) so that the protein was expressed with a C-terminal Myc-6xHis tag. The expression vector was transiently transfected into C2C12-NT and C2C12-30 cells using PEI. Proteins were purified from the culture medium by Ni-NTA agarose affinity chromatography (Qiagen). Equivalent amounts of proteins from each cell line were separated by Nu-PAGE gradient gel (4-12%, Invitrogen), detected using a zinc-stain (BioRad), and bands were cut out and digested with Asp-N protease (Sigma) at 37°C for 16 hours as described (Nita-Lazar and Haltiwanger, 2006). The resulting (glyco)peptides were purified by Zip-Tip (Millipore) and analyzed by nanoLC-MS/MS on an Agilent XCT Ultra ion trap mass spectrometer with a CHIP-Cube interface as described (Leonhard-Melief and Haltiwanger, 2010). The relative quantities of the (glyco)peptides were analyzed by differential MS approach using the extracted ion chromatograms of each ion (Acar et al., 2008). Statistics
Data are shown as mean±s.e.m. P values were determined by Student’s ttest or one-way ANOVA. For Neuro2A differentiation assays, one-way ANOVA was used to compare all groups to Neuro2A-NT, with Dunnet error protection at a 95% confidence interval.
DEVELOPMENT
Genotyping
RESULTS Rumi is the sole enzyme in the mouse capable of adding O-glucose to EGF repeats Drosophila Rumi has three homologs in mammals: Rumi [also known as CAP10-like protein 46 kDa (CLP46) and KTELcontaining 1 (KTELC1)], KDEL-containing 1 (KDELC1) and KDELC2 (Fig. 1A). Among these three proteins, mouse Rumi shares the highest homology with fly Rumi (56% overall identity; 66% identity in the CAP10 domain). The enzymatic and physiological roles of these proteins have not been reported (Kimata et al., 2000; Teng et al., 2006). Biochemical analysis and cross-species overexpression studies in flies indicate that the mouse/human Rumi is the only Drosophila Rumi homolog with similar enzymatic and functional characteristics (H.T., R.F.-V., H.J.N. and R.S.H., unpublished). Therefore, we injected ES cells with gene-trapped Rumi alleles showing ~50% decrease in Rumi mRNA expression (Fig. 1C; see Fig. S1 in the supplementary material) into blastocysts and established a Rumi mutant mouse strain (here referred to as Rumi– or RumiGeo allele) from ES cell line IST10323G11. PCR sequencing and Southern blot with a Neo probe on genomic DNA confirmed a single gene trap insertion in intron 2 of the Rumi gene (Fig. 1B,D,E). qRT-PCR assays on P0 liver extracts of Rumi+/– newborns showed a 50% decrease in Rumi mRNA levels compared with wild-type littermates, demonstrating that the gene trap efficiently blocks the expression of Rumi mRNA (Fig. 2A). Moreover, immunostaining with a polyclonal anti-Rumi antibody (see Fig. S2 in the supplementary material) shows broad expression in wild-type and Rumi+/– embryos but no expression in Rumi–/– embryos (Fig. 2B,C; data not shown). We conclude that this allele in either null or a strong hypomorph. To assess whether a decrease in Rumi levels affects the protein O-glucosyltransferase (Poglut) activity of mouse tissue extracts towards EGF repeats, we performed Poglut assays on liver extracts from newborn Rumi+/– animals and their wild-type littermates. We find that loss of one copy of Rumi results in ~50% decrease in the Poglut activity but no significant change in Pofut1 activity (Fig. 2D), indicating that the effect observed on Poglut activity in Rumi+/– animals is specific. RT-PCR assays show that the other two mammalian homologs of Drosophila Rumi – Kdelc1 and Kdelc2 – are co-expressed with Rumi in neonatal mouse livers and in several mammalian liver cell lines (Fig. 2E). qRT-PCR on liver extracts indicates that Kdelc1/Kdelc2 mRNA are expressed at moderate levels but do not change in Rumi+/– compared with controls (Fig. 2A). Therefore, we conclude that these two proteins are not able to compensate for the loss of one copy of Rumi in the neonatal liver. Western blot analysis using our polyclonal anti-Rumi antibody indicates that Rumi is broadly expressed in neonatal and adult mouse tissues (Fig. 2F), in agreement with previous reports on the broad distribution of Poglut activity in rat tissues (Shao et al., 2002) and human Rumi mRNA in adult human tissues (Teng et al., 2006). Altogether, these data indicate that Rumi is the only Poglut enzyme in the mouse liver (and likely other tissues) able to add an O-linked glucose residue to EGF repeats with a C1-X-S-X-P-C2 consensus motif. Early embryonic lethality and severe cardiovascular defects in embryos lacking Rumi Rumi+/– animals are viable and fertile, and do not exhibit gross developmental abnormalities. From Rumi+/– intercrosses, wild-type and Rumi+/– heterozygous P0 progeny were obtained at a Mendelian ratio, but no newborn Rumi–/– mutants were obtained (Table 1). This observation suggests that Rumi is essential for mouse embryonic
RESEARCH ARTICLE 1927
Fig. 1. Generation of a loss-of-function allele of mouse Rumi. (A)Structure of the mouse CAP10 proteins and their amino acid identity to Drosophila Rumi (dRumi). Blue boxes at N and C termini indicate the signal peptide and the ER-recycling signal, respectively. (B)The top panel shows the structure of the mouse Rumi locus. The vertical arrow shows the insertion site of the gene trap in intron 2 (ex, exon; SA, splice acceptor; pA, polyAdenylation signal; LTR, long terminal repeat; NEO, neomycin resistance gene probe). AvrII (A), BglII (B) and HindIII (H) sites are depicted by vertical lines. (C)qRT-PCR on RNA extracted from wild-type C57BL6 (C57) and the RumiGeo/+ ES cell IST10323G11. Data are mean±s.e.m. (D)Multiplex PCR genotyping on genomic DNA with primers F1, R1 and R2 (5⬘ junction) and F1, R1 and F2 (3⬘ junction). (E)Southern blot analysis with the NEO probe to verify unique insertion of the 6.5 kb VICTR76 gene trap vector in the Rumi locus. Insertion of the gene trap vector in Rumi results in a unique 8.0 kb band upon digestion with AvrII (A). BglII (B) and HindIII (H) digestions each release a unique fragment of ~5.8 kb from the mutant Rumi allele. Note the comparable amounts of digested genomic DNA loaded for C57 and RumiGeo/+ genotypes.
development. We therefore set timed pregnancies to study the embryonic phenotypes of Rumi–/– embryos. At E7.0-E7.5, Rumi–/– embryos could not be morphologically distinguished from their heterozygous and wild-type littermates (not shown). At E8.0, Rumi–/– embryos are characterized by an abnormally expanded neural plate that does not fold properly (Fig. 3C,F; compare with Fig. 3A,B,D,E), absence of heart rudiments (Fig. 3C) and posterior axis truncation. Despite their abnormal morphology, Rumi–/– embryos form the three embryonic germ layers (Fig. 3I; compare with Fig. 3G,H) and an allantois (Fig. 3C). A normal amniotic membrane (a), with its mesodermal and ectodermal components, is present in Rumi–/– embryos (Fig. 3F,I). In Rumi–/– embryos, the anterior ectoderm is expanded and disorganized, especially towards the midline, and the amount of mesodermal tissues seems decreased compared with wildtype and heterozygous embryos (Fig. 3G-I). However, a monolayer of definitive endoderm is present in the ventral side of Rumi–/– embryos, similar to wild-type and heterozygous embryos (Fig. 3G-I). At this stage, somites were observed in wild-type and heterozygous
DEVELOPMENT
Regulation of mammalian Notch by Rumi
1928 RESEARCH ARTICLE
Development 138 (10) Table 1. Rumi homozygous mutants show embryonic lethality Litters Pups Rumi+/+ Rumi+/– Rumi–/–
E7.5
E8.5
E9.5
E10.5
P0
2 18 4 10 4
13 108 28 52 28
8 62 13 33 16
4 41 14 20 7
3 16 6 10 0
Rumi+/– mice intercrosses show that whereas Rumi+/+ and Rumi+/– animals were born at a Mendelian ratio at birth (P0), no Rumi–/– could be identified. Between E7.5 and E9.5 Rumi+/+, Rumi+/– and Rumi–/– could be found at a Mendelian ratio, although at E9.5 most Rumi–/– embryos were in the process of resorption. At E10.5, all Rumi–/– embryos were in resorption, and their number was less than that expected from the Mendelian ratio.
embryos (Fig. 3J,K), but not in Rumi–/– embryos (Fig. 3L). At E8.5, Rumi–/– embryos showed a neural plate that fails to fold properly, but continues to expand in the anterior part of the embryo (arrow in Fig. 3O; compare with Fig. 3M,N). In addition, the posterior parts of the embryo are completely lacking, and the allantois (bracket in Fig. 3O) is directly connected to the anterior embryonic structures. At this stage, we still did not observe any somites or heart formation in Rumi–/– embryos (n28). At E9.5, most Rumi–/– embryos started to show signs of resorption, all of them were unturned and exhibited severe growth retardation, and the neural plate remained unfolded (Fig. 3R; compare with Fig. 3P,Q). By E10.5, all Rumi–/– embryos were in resorption and the number of homozygous mutants was already less than that expected from the Mendelian ratio, indicating that some embryos were fully resorbed at this developmental stage (Table 1). Therefore, Rumi–/– mutants die at or before E9.5, with phenotypes more severe than animals proposed to disrupt canonical Notch signaling like double mutant for presenilin 1 and presenilin 2 (Donoviel et al., 1999), Rbpj (Oka et al., 1995) or Pofut1 (Shi and Stanley, 2003), suggesting that proteins other than the Notch pathway components might also depend on Rumi for their function (see Table S2 in the supplementary material). As cardiovascular phenotypes are one of the hallmarks of Notch pathway mutant phenotypes in mice (Krebs et al., 2000; Shi and Stanley, 2003; Roca and Adams, 2007), we analyzed the cardiovascular development in embryos and yolk sacs between E8.5 to E9.5. Pecam1 staining showed severe cardiovascular defects in E8.5 Rumi–/– embryos, characterized by abnormal vascularization, absence of dorsal aorta and intersomitic vasculature, and cardia bifida (arrowheads indicate unfused cardiogenic plates in Fig. 4C,F; compare with Fig. 4A,B,D,E). At this stage, no Pecam1 staining was observed on the dorsal side of the head structures (Fig. 4F). At E9.5, disorganized vascular networks were present on the dorsal side of the head in some embryos (Fig. 4I; compare with Fig. 4G,H), indicating
Rumi modulates the Notch signaling pathway in mouse cell lines Activation of Notch signaling results in decreased number and length of neurites extended from the Neuro2A mouse neuroblastoma cells, whereas inhibiting Notch signaling causes an increase in the number, length and the branching of neurites in these cells (Franklin et al., 1999; Mishra-Gorur et al., 2002; Ishikura et al., 2005). To test whether downregulation of endogenous Rumi affects Notch signaling and neurite extension, we established Neuro2A cells stably transfected with shRNA-30 – which efficiently knocks down Rumi and decreases the Poglut activity in mouse cell lines (Fig. 5A,B; see Fig. S2 in the supplementary material) – or the control shRNA-NT. qRT-PCR assays show an 89.6% decrease in Hes1 transcript levels in Neuro2A-30 cells compared with the Neuro2A-NT cells (Fig. 5A). Differentiation assays show that after 4 hours in differentiation medium, there is a dramatic increase in the number and the length of neurites upon Rumi knockdown (Fig. 5C,D). Quantification of results from several independent differentiation assays indicates that ~45% of Rumi-knockdown Neuro2A cells harbor extensions longer than one cell diameter after 16-20 hours of differentiation (Fig. 5F,K). Only ~13% of control cells had such extensions (Fig. 5E,K). These results strongly suggest that Rumi regulates Notch signaling and neurite extension in Neuro2A cells. To ensure that the effects observed in Neuro2A-30 cells are not due to off-target effects, we asked whether human Rumi (hRumi) – which is not affected by shRNA-30 (not shown) – can rescue the neurite phenotypes caused by mouse Rumi (mRumi) knockdown. We find that hRumi-FLAG, but not the empty vector, can rescue the increased neurite extension phenotype caused by shRNA-30 (Fig. 5G,H,K). To address whether Rumi plays a non-enzymatic role in mammalian cells, we overexpressed hRumi-G169E-FLAG,
DEVELOPMENT
Fig. 2. Rumi is the primary Poglut in the mouse. (A)qRT-PCR for Rumi, Kdelc1 and Kdelc2 on neonatal liver extracts from Rumi+/– and Rumi+/+. *P0.003. Data are mean±s.e.m. The ranges of Ct values in the wild-type liver are 26.7-27.3 (Rumi), 28.2-29.0 (Kdelc1) and 27.028.1 (Kdelc2). (B,C)Sagittal section of E8.0 Rumi+/+ and Rumi–/– embryos stained with anti-Rumi antibody. Identical staining protocol and image acquisition and processing parameters were used for both genotypes. (D)Poglut and Pofut1 enzymatic assays on the neonatal liver extracts from Rumi+/– and Rumi+/+ mice. #P<0.002. Data are mean±s.e.m. (E)RT-PCR assays on neonatal mouse liver and cell lines derived from human hepatocellular carcinoma (HepG2), and from adult (NMuLi) and embryonic (BNL CL2) mouse liver. (F)Western blot analysis shows that Rumi is broadly expressed in the newborn and adult mouse tissues. cbl, cerebellum.
that vascular development continued beyond E8.5, albeit in an abnormal manner. At E9.5, Rumi–/– embryos showed no heart, and the cardiogenic plates were still unfused (Fig. 4I). Whole-mount staining of the yolk sacs with anti-Pecam1 showed severe vascular remodeling defects in Rumi–/– at E8.75. Rumi–/– yolk sacs contained large blood sinusoids (Fig. 4L) instead of the normal vascular trees observed in wild-type and heterozygous yolk sacs (Figs 4J,K). In wild-type and Rumi+/– animals, Pecam1 staining of yolk sac sections at E8.75 shows a characteristic membrane staining of endothelial cells (Fig. 4M,N,P,Q). By contrast, Rumi–/– yolk sacs show a diffuse staining for Pecam1 and a lack of endothelial remodeling (Fig. 4O,R). Defects in vascular remodeling and dorsal aorta formation are reported in various mutant backgrounds affecting the Notch signaling pathway (Krebs et al., 2000; Shi and Stanley, 2003; Roca and Adams, 2007). Given the severe growth retardation of Rumi–/– embryos, it is difficult to ascertain that the only cause of the observed vascular defects is indeed loss of Notch signaling.
Fig. 3. Loss of Rumi results in severe growth retardation and multiple abnormalities in mouse embryos. (A-L)Hematoxylin and Eosin staining of sagittal sections of E8.0 embryos. (A-F)At E8.0, Rumi–/– embryos display expansion of the dorsal anterior structures (arrow), absence of cardiac rudiments (arrowhead in A,B) and axis shortening/truncation. However, the allantois (brackets in A-C,M-O,R) is present in mutant embryos (C). Scale bars: 100m. D-F are higher magnification of the boxed areas in A-C. Whereas wild-type (D) and heterozygous (E) embryos display normal organization of the neural ectoderm (ec) and cephalic mesenchyme (me), Rumi–/– embryos (F) show a disorganized ectoderm (ec). A normal, bilayered amniotic membrane (a) is present in Rumi–/– embryos. Scale bars: 50m. (G-I)Sections from the anterior region of E8.0 embryos. Rumi–/– embryos (I) do form ectoderm (ec), mesoderm (m) and endoderm (en) layers, but the amount of mesodermal tissue seems to be reduced. As the amniotic cavity of Rumi–/– embryos is smaller than their wild-type and heterozygous counterparts, the amniotic membrane (a) is visible in the Rumi–/– embryo section (I). Scale bars: 50m. (J-L)Somites (dashed ovals) can be seen in sagittal sections of E8.0 wild-type (J) and heterozygous (K) embryos, but not in Rumi–/– embryos (L). Scale bars: 20m. (M-O)At E8.5, Rumi–/– embryos exhibit an unfolded neural plate (arrow in O) and posterior axis truncation, with an allantois directly connected to the anterior structures. Scale bars: 500m. (P-R)At E9.5, Rumi–/– embryos exhibit severe growth retardation and a neural tube that remains unfolded (arrow in R). Scale bars: 500m. (M-R)Lateral views.
RESEARCH ARTICLE 1929
Fig. 4. Pecam1 staining reveals severe cardiovascular defects in Rumi mutant embryos. (A-I)Pecam1 staining of embryos and yolk sacs. (A-F)At E8.5, Rumi–/– embryos show cardia bifida, characterized by unfused cardiogenic plates (arrowheads) and absence of dorsal aorta. C and F are ventral and dorsal views of the same embryo, respectively. The heart is indicated by an arrow in A,B,D,E. Scale bars: 500m. (G-I)At E9.5, Rumi–/– embryos show no heart, with the cardiogenic plates still unfused (arrowheads) and severely abnormal vascularization. (I)Dorsal view. Scale bars: 1 mm. (J-L)At E8.75, Rumi–/– yolk sacs show abnormal vascular remodeling, characterized by the presence of several blood sinusoids. Scale bars: 1 mm. (M-R)Pecam1 staining of E8.75 yolk sacs marks the endothelial cells (arrows) in wildtype (P) and heterozygous (Q) animals. Note the diffused Pecam1 staining and absence of endothelial remodeling (arrowhead in R) in Rumi–/– animals. Scale bars: 50m. P-R are high magnification views of boxed areas in M-O. Scale bars: 10m.
which is enzymatically inactive (Fig. 5J), in Neuro2A-30 cells. hRumi-G169E-FLAG is not able to rescue the neurite outgrowth phenotype in Neuro2A-30 cells (Fig. 5I,K), even though hRumiFLAG and hRumi-G169E-FLAG are expressed at comparable levels upon transient transfection (see Fig. S3 in the supplementary material). Altogether, these observations indicate that a decrease in the Poglut activity caused by mRumi knockdown significantly promotes neurite extension in Neuro2A cells, most probably owing to a decrease in Notch signaling. We also assessed the effects of Rumi knockdown on Notch Oglucosylation and signaling in the C2C12 mouse myoblast cells. Stable transfection of C2C12 cells with shRNA-30 results in a 90% decrease in Poglut activity compared with control cells (Fig. 6A),
DEVELOPMENT
Regulation of mammalian Notch by Rumi
Fig. 5. Rumi knockdown promotes neurite extension in the Neuro2A neuroblastoma cell line. (A)qRT-PCR assays show a ~67% decrease in Rumi transcript levels (P0.0006) and an 89.6% decrease in Hes1 levels (P0.0016) in Neuro2A-30 cells compared with that in the Neuro2A-NT cells. (B)Poglut assays show a ~65% decrease in the enzymatic activity of Neuro2A-30 cells compared with Neuro2A-NT cells. Data in A,B are mean±s.e.m. (C,D)Differentiation assays at 4 hours on Neuro2A-NT and Neuro2A-30 cells. (E-I)Differentiation assays at 16-20 hours on Neuro2A-NT (E), Neuro2A-30 (F) and Neuro2A-30 cells transiently transfected with pTracer empty vector (G), pTracerhRumi-FLAG (H) and pTracer-hRumi-G169E-FLAG (I). (J)Poglut assays indicate that hRumi-G169E-FLAG is enzymatically inactive. (K)Percentage of cells bearing neurites longer than one cell diameter after 16-20 hours of differentiation. Letters on the x-axis show the data for the corresponding panels. One-way ANOVA indicates that (E) is significantly different from all others except for (H) (P<0.0001). t-test indicates that the percentage of cells with neurites in Neuro2A-30 (F) is significantly different from Neuro2A-30-hRumi (H) (P0.0008), but not from Neuro2A-30-G169E cells (I) (P0.49). Data in J,K are mean±s.e.m.
despite moderate to high level expression of Kdelc1 and Kdelc2 in these cells (data not shown). To examine the effects of Rumi knockdown on O-glycosylation of Notch EGF repeats, we performed differential mass spectrometry (Acar et al., 2008) on a Myc-6xHis-tagged fragment of the Notch2 extracellular domain harboring EGF13-18 expressed in C2C12-NT and C2C12-30 cells (Fig. 6B-E). The results suggest that the mNotch2 EGF repeats contain an O-linked xylose-xylose-glucose trisaccharide (see Fig. S4 in the supplementary material), which is identical to those found on EGF repeats from mNotch1 (Moloney et al., 2000; Bakker et al., 2009; Whitworth et al., 2010). A significant decrease in the Oglucosylated form and a corresponding increase in the unglucosylated form of peptides from EGF 13, 16, 17 and 18 were observed in samples from C2C12-30 cells compared with those in C2C12-NT cells (Fig. 6B-E and not shown). These data demonstrate that reduction in mammalian Rumi causes a reduction in the levels of O-glucosylation of Notch EGF repeats. Of note, a significant amount of the unglucosylated peptide from EGF16 was detected in the control sample (Fig. 6D), strongly suggesting that different Notch EGF repeats show different levels of O-glucose occupancy at endogenous levels of Rumi.
Development 138 (10)
Fig. 6. Rumi knockdown results in decreased Notch signaling and reduced Notch O-glucosylation in C2C12 cells. (A)Poglut assays show a ~90% decrease in the enzymatic activity of C2C12-30 cells compared with C2C12-NT cells. Data are mean±s.e.m. (B-E)Rumi knockdown by shRNA-30 results in a dramatic decrease in the levels of O-glucosylation of Notch2 EGF repeats as shown by mass spectrometry. (B)The unglucosylated form of the 470EVNECQSNPCVNNGQCV486 peptide from EGF13 is present in the Rumi knockdown sample but not in the control. Underline indicates the O-glucosylated serine. (C)The Oglucosylated form of this peptide is more abundant in the control than in the Rumi knockdown sample. (D)The unglucosylated form of the 585 DECYSSPCLN594 peptide from EGF16 is more abundant in the Rumi knockdown sample than in the control. Underline indicates the Oglucosylated serine. (E)The O-glucosylated form of this peptide is more abundant in the control than in the Rumi knockdown sample. See Fig. S4 in the supplementary material for MS and MS/MS spectra for B-E. (F)qRT-PCR for Hey1 and Hes1 on C2C12-30 and C2C12-NT cells. Data are mean±s.e.m. (G)Western blot using anti-Val1744 antibody (V1744). a-Tubulin (Tub) was used as loading control.
qRT-PCR assays for the Notch pathway effectors show a 92% decrease in Hey1 mRNA and a 59% decrease in Hes1 mRNA in C2C12-30 cells (Fig. 6F). We also performed western blots on protein extracts from C2C12-30 and C2C12-NT cells with antiVal1744 – an antibody that specifically recognizes the g-secretase cleavage product of Notch1 (Huppert et al., 2005). We find a dramatic reduction in the level of activated Notch1 in C2C12-30 cells (Fig. 6G). These data directly link the function of Rumi to the regulation of Notch signaling in C2C12 cells, and strongly suggest that the Poglut activity of Rumi is required for the activation of Notch1 in these cells. To begin to address the mechanism of loss of Notch signaling in C2C12-30 cells, we asked whether Rumi regulates the surface expression and ligand binding of Notch in these cells. Biotinylation assays indicate that Notch1 reaches the surface of both C2C12-30 and C2C12-NT cells (Fig. 7A). Flow cytometry with an antiNotch1 antibody confirms this observation but indicates a 20% decrease in the level of Notch1 at the surface of C2C12-30 cells compared with C2C12-NT cells (Fig. 7B). However, this modest decrease in Notch1 surface levels cannot explain the severe decrease in the level of Notch target expression and activated form
DEVELOPMENT
1930 RESEARCH ARTICLE
Regulation of mammalian Notch by Rumi
RESEARCH ARTICLE 1931
Fig. 7. Notch ligand binding is not decreased upon Rumi knockdown. (A)Biotinylation assays on C2C12-NT and C2C12-30 cells show that Notch1 is present at the surface of both cell lines, as evidenced by the immunodetection of the N1ICD in the Avidin-bound samples. Data are representative from three independent experiments. -Actin was used to indicate that intracellular proteins are not present in the Avidinbound fraction, and also serves as a loading control for the input. TM-ICD indicates migration position of the transmembrane-intracellular fragment of Notch1. Asterisk indicates a non-specific C-terminal truncation of the TM-ICD, which is still exposed extracellularly and can be labeled by biotin. (B)Flow cytometry of Notch1 cell surface expression. Surface Notch1 was detected on both C2C12-NT and C2C12-30 cells (black dots to the right of the vertical line in the forward scatter plots). A modest yet significant difference in the mean fluorescence intensities (MFI) between C2C12-NT (MFI: 20580±340) and C2C12-30 (MFI: 16081±147) was observed (n3, P0.0003). Notch1 heterodimer removal by EDTA treatment resulted in negative immunolabeling. (C)Flow cytometry of ligand binding. Unlike the Fc negative control (a,d), both C2C12-NT and C2C12-30 cells strongly bind Jag1 (J1) and Delta-like1 (Dll1) (dark-gray histograms in b,c,e,f). No statistically significant difference was observed in their binding ability towards Jag1 (P0.25) or Delta-like1 (P0.92), as determined by comparison of the mean fluorescence intensities: C2C12-NT, J1 (MFI: 15819±435); C2C12-30, J1 (MFI: 17817±1423); C2C12-NT, Dll1 (MFI: 10402±491); C2C12-30, Dll1 (MFI: 10312±660). Incubation with EDTA/Ca++ (J1-EDTA/Ca++ and Dll1-EDTA/Ca++) results in leftward shift of the histograms (light-gray histograms in b,c,e,f), indicating the specificity of the binding assays. Flow cytometry profiles are representative of three independent experiments.
of Notch1 upon Rumi knockdown. Moreover, flow cytometric analysis of ligand binding indicates that Rumi knockdown in C2C12-30 cells does not decrease the ability of Notch receptors to
bind Jag1 and Delta-like1 ligands (Fig. 7C). Altogether, these data strongly suggest that Rumi primarily regulates Notch signaling at a step between ligand binding and S3 cleavage. In addition to Notch receptors, most canonical ligands in mammals have between one to four Rumi target motifs (see Fig. S5 in the supplementary material and not shown) (Jafar-Nejad et al., 2010). To examine whether O-glucosylation is required for the function of mammalian Notch ligands, we performed cross-species transgenic analyses in Drosophila, where rumi mutations result in a complete loss of Notch signaling at 30°C (Acar et al., 2008). Overexpression of rat Delta-like 1 (Dll1) – with two predicted Rumi target EGF repeats – in rumi mutant clones in third instar wing imaginal discs raised at 30°C was able to induce Notch signaling in neighboring cells, as evidenced by the strong induction of the Notch downstream target Cut (Fig. 8A-B⬘). We performed similar experiments to examine whether the function of Jag1 and Dll3 depends on Rumi, but were not able to reach a conclusion, because these two mammalian ligands did not induce Notch signaling in wild-type or Rumi–/– clones in Drosophila using this assay (see Fig. S5 in the supplementary material), in agreement with a previous report on Dll3 (Geffers et al., 2007). These data suggest that Oglucosylation by Rumi is not essential for the function of the rat Dll1. Rumi regulates Jag1-induced Notch signaling in a dosage-sensitive manner in the mouse liver To provide further in vivo evidence for the regulation of mouse Notch signaling by Rumi, we sought to determine whether decreasing the level of Rumi affects mouse Notch signaling in a Jag1+/– haploinsufficient background, as these animals are especially sensitive to alterations in the gene dose of other Notch
DEVELOPMENT
Fig. 8. Protein O-glucosylation is not essential for the function of rat Dll1 in Drosophila. GFP-NLS marks MARCM clones of a wild-type chromosome (A) or the rumiD26 null allele (B) simultaneously expressing rat Dll1. (A-B⬘) Expression of rat Dll1 in rumi clones induces a strong expression of the Notch downstream target Cut in neighboring cells outside the clones (B,B⬘), similar to wild-type clones expressing rat Dll1 (A,A⬘). In wild-type cells, rat Dll1 does not show a cis-inhibitory effect on Drosophila Notch and is able to induce Cut expression in the clones (A,A⬘), as reported previously (Geffers et al., 2007). However, inside rumi clones, induction of Cut by rat Dll1 is abolished, most probably because of the impaired reception of Notch signaling in rumi clones. Asterisks in A and B indicate the endogenous wing margin, which expresses Cut independently of the rat Dll1 overexpression.
Fig. 9. Genetic interaction between Rumi and Jag1 in the mouse. (A-I)DBA histochemical staining of biliary cells in P0 livers. Patent bile ducts (arrows) and biliary cells are found around the portal vein (pv) in wild-type (A), Rumi+/– (B), Jag1dDSL/+ (C), Notch2del3/+ (D) and Rumi+/–, Notch2del3/+ (H,I) animals. By contrast, Jag1dDSL/+, Rumi+/– livers show bile duct paucity, with either no biliary cells (E) or a few scattered ones (arrowhead in F), similar to Jag1dDSL/+, Notch2del3/+ livers (G). (J,K)Rumi immunofluorescent stainings of E18.5 liver sections. (K)A high magnification view of the area outlined in J showing the punctate cytoplasmic pattern of Rumi expression in a cluster of cells.
pathway components (Xue et al., 1999; McCright et al., 2001; McCright et al., 2002; Ryan et al., 2008). We crossed the Rumi+/– mice to animals heterozygous for the null allele Jagged1dDLS (Xue et al., 1999) and analyzed liver sections of P0 animals double heterozygous for the null allele Jagged1dDLS (Xue et al., 1999), and our Rumi allele and also their control littermates for binding to the Dolichos biflorus agglutinin (DBA) – a marker for bile duct epithelial cells (Watanabe et al., 1981). P0 livers of Rumi+/– mice showed patent bile ducts and numerous biliary cells around the portal veins, similar to their wild-type littermates and animals heterozygous for Jagged1dDSL or the null allele Notch2del3 (McCright et al., 2006) (Fig. 9A-D). However, all of the five P0 Jag1+/–, Rumi+/– double heterozygous mice analyzed in our studies displayed bile duct paucity and a severe decrease in the number of biliary cells in the periportal regions (Fig. 9E,F). As positive control, we generated P0 animals double heterozygous for Jagged1dDSL and the null allele Notch2del3. These mice also showed bile duct phenotypes comparable with Jag1+/–, Notch2del1/+ (hypomorphic) (McCright et al., 2002) and Jag1+/–, Rumi+/– animals (compare Fig. 9G with 9E,F). Of note, P0 animals double heterozygous for Rumi– and Notch2del3 have patent bile ducts in the periportal regions (Fig. 9H,I). Anti-Rumi staining of wild-type E18.5 liver sections shows that some cells in the periportal regions express high levels of Rumi, in agreement with a dose-sensitive role in bile duct morphogenesis (Fig. 9G,K). These observations indicate that Rumi regulates mammalian Notch signaling in vivo, and that Jag1-induced signaling is sensitive to the gene dosage of Rumi.
Development 138 (10)
DISCUSSION Multiple lines of evidence indicate that, similar to its Drosophila homolog, mouse Rumi regulates Notch signaling. Notch signaling negatively regulates the number, length and branching of neurites in Neuro2A cells (Franklin et al., 1999; Mishra-Gorur et al., 2002; Ishikura et al., 2005). Therefore, increased neurite outgrowth and decreased Hes1 expression upon RNAi-mediated knockdown of Rumi in Neuro2A cells indicate a role for Rumi in the modulation of Notch signaling. In C2C12 cells, Rumi knockdown results in a significant decrease in Poglut activity and impaired Notch1 signaling, as evidenced by reduced levels of activated Notch1 ICD and Hey1 and Hes1 mRNA. Last but not least, removing one copy of Rumi results in bile duct defects in Jag1+/– haploinsufficient animals. Together, these data provide strong evidence that mammalian Notch signaling is modulated by Rumi. EGF repeats of both Notch1 (Moloney et al., 2000; Bakker et al., 2009; Whitworth et al., 2010) and Notch2 (Fig. 6) are Oglucosylated in mammalian cell lines. Despite the co-expression of moderate levels of Kdelc1 and Kdelc2 with Rumi, we observe a significant decrease in Poglut activity and the level of Oglucosylated Notch2 EGF repeats in Rumi knockdown C2C12 cells and a ~50% reduction in Poglut activity in Rumi+/– heterozygous livers. These data strongly suggest that of the three soluble ER proteins with a CAP10 domain found in mammals, Rumi is the only one able to add O-glucose to Notch proteins. The lack of compensation by KDELC1 and KDELC2 might be because these proteins lack a WXGG motif, which is thought to mediate the binding of clostridial O-glucosyltransferases to UDP-glucose (Busch et al., 2000) and is present in fly and mammalian Rumi proteins. Therefore, both in mouse cell lines and in the developing liver, the Notch loss-of-function phenotypes observed upon decreased Rumi levels correlate with decreased Poglut activity. The significant increase in neurite outgrowth observed in Rumi knockdown Neuro2A cells can be rescued by overexpression of hRumi but not with an enzymatically inactive mutant version of hRumi. These observations, together with our flow cytometry data and the severe decrease in Notch1 ICD in C2C12-30 cells strongly suggest that addition of O-glucose to Notch pathway components regulates mammalian Notch signaling at a step between ligand binding and S3 cleavage of Notch receptors. Even though Notch1-4 quadruple knockout phenotypes are not known, comparison of the phenotypes displayed by Rumi–/– embryos with those of global regulators of canonical Notch signaling (Oka et al., 1995; Donoviel et al., 1999; Shi and Stanley, 2003) suggests that in addition to the Notch pathway components, other proteins are likely to depend on the function of Rumi during mouse embryonic development. We performed extensive database searches and identified 47 mouse proteins with EGF repeats harboring a consensus O-glucosylation motif (see Table S2 in the supplementary material). We found reports on mutant phenotypes for 38 of these targets, but to our knowledge none of these mutants exhibit the combination of phenotypes observed in Rumi–/– embryos (see Table S2 in the supplementary material and references therein). It is therefore likely that a combined defect in several targets of Rumi including the Notch pathway components is responsible for the early lethality and the phenotypes observed in Rumi–/– embryos. The dosage-sensitive interaction observed between Jag1 and Rumi strongly suggests that when the level of Jag1 is limiting, optimal Jag1-induced signaling becomes sensitive to the degree of
DEVELOPMENT
1932 RESEARCH ARTICLE
O-glucosylation conferred by Rumi on one or more Notch pathway components. The high-level expression of Rumi in a subset of periportal cells suggests that in this context optimal Notch signaling requires high levels of O-glucose occupancy on Notch EGF repeats. Even though Notch2 plays a dominant role in bile duct morphogenesis, analysis of the three dimensional architecture of the intrahepatic bile ducts indicates that, in addition to Notch2, Notch1 and potentially other Notch receptors contribute to bile duct formation in a redundant fashion (Sparks et al., 2010). Accordingly, our observation that newborn Rumi+/–, Notch2del3/+ animals do not show bile duct phenotypes suggests that decreased glucosylation of several Notch receptors and/or the Jag1 protein itself contributes to the bile duct abnormalities in Jag1+/–, Rumi+/– double heterozygous animals. Mutations in JAG1 are identified in 94% of individuals with Alagille syndrome (Warthen et al., 2006). However, it is not uncommon to find other family members of an affected child with the same point mutation in JAG1 but with much milder symptoms, strongly suggesting that genetic and/or environmental modifiers play a significant role in the clinical presentation and prognosis of this disease (Li et al., 1997; Emerick et al., 1999). Our data suggest that human RUMI (POGLUT1) might represent a genetic modifier of JAG1 phenotypes in individuals with Alagille syndrome. Acknowledgements We thank Nadia Rana, Yi-Dong Li, Zhengmei Mao, Shinako Kakuda, Eva Zsigmond, Aleksey Domozhirov, Zizhen Wu, Jim Martin, David Haviland and Nathalie Brouard for technical assistance; Pamela Stanley and members of the Jafar-Nejad and Haltiwanger labs for discussions; Rafi Kopan, Bernadette Holdener and Tom Van Lee for comments on the manuscript; and Tom Gridley, Robert Jaekel, Thomas Klein, Pamela Stanley, Rafi Kopan and the Developmental Studies Hybridoma Bank for animals and reagents. We acknowledge support from the NIH (R01GM084135 to H.J.-N. and R01GM061126 to R.S.H.), from The March of Dimes Foundation (Basil O’Connor Starter Scholar Research Award No. 5-FY07-654 and Research Grant No. 1-FY10-362 to H.J.-N.) and from the Mizutani Foundation for Glycoscience (H.T.). Deposited in PMC for release after 12 months. Competing interests statement The authors declare no competing financial interests. Supplementary material Supplementary material for this article is available at http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.060020/-/DC1 References Acar, M., Jafar-Nejad, H., Takeuchi, H., Rajan, A., Ibrani, D., Rana, N. A., Pan, H., Haltiwanger, R. S. and Bellen, H. J. (2008). Rumi is a CAP10 domain glycosyltransferase that modifies Notch and is required for Notch signaling. Cell 132, 247-258. Bakker, H., Oka, T., Ashikov, A., Yadav, A., Berger, M., Rana, N. A., Bai, X., Jigami, Y., Haltiwanger, R. S., Esko, J. D. et al. (2009). Functional UDP-xylose transport across the endoplasmic reticulum/Golgi membrane in a Chinese hamster ovary cell mutant defective in UDP-xylose Synthase. J. Biol. Chem. 284, 2576-2583. Bischof, J., Maeda, R. K., Hediger, M., Karch, F. and Basler, K. (2007). An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. USA 104, 3312-3317. Bulman, M. P., Kusumi, K., Frayling, T. M., McKeown, C., Garrett, C., Lander, E. S., Krumlauf, R., Hattersley, A. T., Ellard, S. and Turnpenny, P. D. (2000). Mutations in the human delta homologue, DLL3, cause axial skeletal defects in spondylocostal dysostosis. Nat. Genet. 24, 438-441. Busch, C., Hofmann, F., Gerhard, R. and Aktories, K. (2000). Involvement of a conserved tryptophan residue in the UDP-glucose binding of large clostridial cytotoxin glycosyltransferases. J. Biol. Chem. 275, 13228-13234. Chang, Y. C. and Kwon-Chung, K. J. (1999). Isolation, characterization, and localization of a capsule-associated gene, CAP10, of Cryptococcus neoformans. J. Bacteriol. 181, 5636-5643. Donoviel, D. B., Hadjantonakis, A. K., Ikeda, M., Zheng, H., Hyslop, P. S. and Bernstein, A. (1999). Mice lacking both presenilin genes exhibit early embryonic patterning defects. Genes Dev. 13, 2801-2810.
RESEARCH ARTICLE 1933 Eldadah, Z. A., Hamosh, A., Biery, N. J., Montgomery, R. A., Duke, M., Elkins, R. and Dietz, H. C. (2001). Familial tetralogy of Fallot caused by mutation in the jagged1 gene. Hum. Mol. Genet. 10, 163-169. Ellisen, L. W., Bird, J., West, D. C., Soreng, A. L., Reynolds, T. C., Smith, S. D. and Sklar, J. (1991). TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66, 649-661. Emerick, K. M., Rand, E. B., Goldmuntz, E., Krantz, I. D., Spinner, N. B. and Piccoli, D. A. (1999). Features of Alagille syndrome in 92 patients: frequency and relation to prognosis. Hepatology 29, 822-829. Fernandez-Valdivia, R., Jeong, J., Mukherjee, A., Soyal, S. M., Li, J., Ying, Y., Demayo, F. J. and Lydon, J. P. (2010). A mouse model to dissect progesterone signaling in the female reproductive tract and mammary gland. Genesis 48, 106113. Fortini, M. E. (2009). Notch signaling: the core pathway and its posttranslational regulation. Dev. Cell 16, 633-647. Franklin, J. L., Berechid, B. E., Cutting, F. B., Presente, A., Chambers, C. B., Foltz, D. R., Ferreira, A. and Nye, J. S. (1999). Autonomous and nonautonomous regulation of mammalian neurite development by Notch1 and Delta1. Curr. Biol. 9, 1448-1457. Garg, V., Muth, A. N., Ransom, J. F., Schluterman, M. K., Barnes, R., King, I. N., Grossfeld, P. D. and Srivastava, D. (2005). Mutations in NOTCH1 cause aortic valve disease. Nature 437, 270-274. Geffers, I., Serth, K., Chapman, G., Jaekel, R., Schuster-Gossler, K., Cordes, R., Sparrow, D. B., Kremmer, E., Dunwoodie, S. L., Klein, T. et al. (2007). Divergent functions and distinct localization of the Notch ligands DLL1 and DLL3 in vivo. J. Cell Biol. 178, 465-476. Hansen, G. M., Markesich, D. C., Burnett, M. B., Zhu, Q., Dionne, K. M., Richter, L. J., Finnell, R. H., Sands, A. T., Zambrowicz, B. P. and Abuin, A. (2008). Large-scale gene trapping in C57BL/6N mouse embryonic stem cells. Genome Res. 18, 1670-1679. Harris, R. J. and Spellman, M. W. (1993). O-linked fucose and other posttranslational modifications unique to EGF modules. Glycobiology 3, 219-224. Hase, S., Kawabata, S., Nishimura, H., Takeya, H., Sueyoshi, T., Miyata, T., Iwanaga, S., Takao, T., Shimonishi, Y. and Ikenaka, T. (1988). A new trisaccharide sugar chain linked to a serine residue in bovine blood coagulation factors VII and IX. J. Biochem. (Tokyo) 104, 867-868. Hicks, C., Johnston, S. H., diSibio, G., Collazo, A., Vogt, T. F. and Weinmaster, G. (2000). Fringe differentially modulates Jagged1 and Delta1 signalling through Notch1 and Notch2. Nat. Cell Biol. 2, 515-520. Huppert, S. S., Ilagan, M. X., De Strooper, B. and Kopan, R. (2005). Analysis of Notch function in presomitic mesoderm suggests a gamma-secretaseindependent role for presenilins in somite differentiation. Dev. Cell 8, 677-688. Ishikura, N., Clever, J. L., Bouzamondo-Bernstein, E., Samayoa, E., Prusiner, S. B., Huang, E. J. and DeArmond, S. J. (2005). Notch-1 activation and dendritic atrophy in prion disease. Proc. Natl. Acad. Sci. USA 102, 886-891. Jafar-Nejad, H., Leonardi, J. and Fernandez-Valdivia, R. (2010). Role of glycans and glycosyltransferases in the regulation of Notch signaling. Glycobiology 20, 931-949. Joutel, A., Corpechot, C., Ducros, A., Vahedi, K., Chabriat, H., Mouton, P., Alamowitch, S., Domenga, V., Cecillion, M., Marechal, E. et al. (1996). Notch3 mutations in CADASIL, a hereditary adult-onset condition causing stroke and dementia. Nature 383, 707-710. Kimata, Y., Ooboki, K., Nomura-Furuwatari, C., Hosoda, A., Tsuru, A. and Kohno, K. (2000). Identification of a novel mammalian endoplasmic reticulumresident KDEL protein using an EST database motif search. Gene 261, 321-327. Kopan, R. and Ilagan, M. X. (2009). The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 137, 216-233. Krebs, L. T., Xue, Y., Norton, C. R., Shutter, J. R., Maguire, M., Sundberg, J. P., Gallahan, D., Closson, V., Kitajewski, J., Callahan, R. et al. (2000). Notch signaling is essential for vascular morphogenesis in mice. Genes Dev. 14, 13431352. Kuhnert, F., Campagnolo, L., Xiong, J. W., Lemons, D., Fitch, M. J., Zou, Z., Kiosses, W. B., Gardner, H. and Stuhlmann, H. (2005). Dosage-dependent requirement for mouse Vezf1 in vascular system development. Dev. Biol. 283, 140-156. Lee, S. Y., Kumano, K., Nakazaki, K., Sanada, M., Matsumoto, A., Yamamoto, G., Nannya, Y., Suzuki, R., Ota, S., Ota, Y. et al. (2009). Gainof-function mutations and copy number increases of Notch2 in diffuse large Bcell lymphoma. Cancer Sci. 100, 920-926. Lee, T. and Luo, L. (2001). Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development. Trends Neurosci. 24, 251-254. Leonhard-Melief, C. and Haltiwanger, R. S. (2010). O-fucosylation of thrombospondin type 1 repeats. Methods Enzymol. 480, 401-416. Li, L., Krantz, I. D., Deng, Y., Genin, A., Banta, A. B., Collins, C. C., Qi, M., Trask, B. J., Kuo, W. L., Cochran, J. et al. (1997). Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1. Nat. Genet. 16, 243-251. Lu, F. M. and Lux, S. E. (1996). Constitutively active human Notch1 binds to the transcription factor CBF1 and stimulates transcription through a promoter
DEVELOPMENT
Regulation of mammalian Notch by Rumi
containing a CBF1-responsive element. Proc. Natl. Acad. Sci. USA 93, 56635667. Matsuura, A., Ito, M., Sakaidani, Y., Kondo, T., Murakami, K., Furukawa, K., Nadano, D., Matsuda, T. and Okajima, T. (2008). O-linked Nacetylglucosamine is present on the extracellular domain of notch receptors. J. Biol. Chem. 283, 35486-35495. McCright, B., Gao, X., Shen, L., Lozier, J., Lan, Y., Maguire, M., Herzlinger, D., Weinmaster, G., Jiang, R. and Gridley, T. (2001). Defects in development of the kidney, heart and eye vasculature in mice homozygous for a hypomorphic Notch2 mutation. Development 128, 491-502. McCright, B., Lozier, J. and Gridley, T. (2002). A mouse model of Alagille syndrome: Notch2 as a genetic modifier of Jag1 haploinsufficiency. Development 129, 1075-1082. McCright, B., Lozier, J. and Gridley, T. (2006). Generation of new Notch2 mutant alleles. Genesis 44, 29-33. Mishra-Gorur, K., Rand, M. D., Perez-Villamil, B. and Artavanis-Tsakonas, S. (2002). Down-regulation of Delta by proteolytic processing. J. Cell Biol. 159, 313-324. Moffat, J., Grueneberg, D. A., Yang, X., Kim, S. Y., Kloepfer, A. M., Hinkle, G., Piqani, B., Eisenhaure, T. M., Luo, B., Grenier, J. K. et al. (2006). A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124, 1283-1298. Moloney, D. J., Shair, L. H., Lu, F. M., Xia, J., Locke, R., Matta, K. L. and Haltiwanger, R. S. (2000). Mammalian Notch1 is modified with two unusual forms of O-linked glycosylation found on epidermal growth factor-like modules. J. Biol. Chem. 275, 9604-9611. Mumm, J. S., Schroeter, E. H., Saxena, M. T., Griesemer, A., Tian, X., Pan, D. J., Ray, W. J. and Kopan, R. (2000). A ligand-induced extracellular cleavage regulates gamma-secretase-like proteolytic activation of Notch1. Mol. Cell 5, 197-206. Nita-Lazar, A. and Haltiwanger, R. S. (2006). Methods for analysis of O-linked modifications on epidermal growth factor-like and thrombospondin type 1 repeats. Methods Enzymol. 417, 93-111. Oda, T., Elkahloun, A. G., Pike, B. L., Okajima, K., Krantz, I. D., Genin, A., Piccoli, D. A., Meltzer, P. S., Spinner, N. B., Collins, F. S. et al. (1997). Mutations in the human Jagged1 gene are responsible for Alagille syndrome. Nat. Genet. 16, 235-242. Oka, C., Nakano, T., Wakeham, A., de la Pompa, J. L., Mori, C., Sakai, T., Okazaki, S., Kawaichi, M., Shiota, K., Mak, T. W. et al. (1995). Disruption of the mouse RBP-J kappa gene results in early embryonic death. Development 121, 3291-3301. Okajima, T. and Irvine, K. D. (2002). Regulation of notch signaling by o-linked fucose. Cell 111, 893-904. Rampal, R., Arboleda-Velasquez, J. F., Nita-Lazar, A., Kosik, K. S. and Haltiwanger, R. S. (2005). Highly conserved O-fucose sites have distinct effects on Notch1 function. J. Biol. Chem. 280, 32133-32140.
Development 138 (10) Roca, C. and Adams, R. H. (2007). Regulation of vascular morphogenesis by Notch signaling. Genes Dev. 21, 2511-2524. Ryan, M. J., Bales, C., Nelson, A., Gonzalez, D. M., Underkoffler, L., Segalov, M., Wilson-Rawls, J., Cole, S. E., Moran, J. L., Russo, P. et al. (2008). Bile duct proliferation in Jag1/fringe heterozygous mice identifies candidate modifiers of the Alagille syndrome hepatic phenotype. Hepatology 48, 1989-1997. Sasamura, T., Sasaki, N., Miyashita, F., Nakao, S., Ishikawa, H. O., Ito, M., Kitagawa, M., Harigaya, K., Spana, E., Bilder, D. et al. (2003). neurotic, a novel maternal neurogenic gene, encodes an O-fucosyltransferase that is essential for Notch-Delta interactions. Development 130, 4785-4795. Shao, L., Luo, Y., Moloney, D. J. and Haltiwanger, R. (2002). O-glycosylation of EGF repeats: identification and initial characterization of a UDP-glucose: protein O-glucosyltransferase. Glycobiology 12, 763-770. Shi, S. and Stanley, P. (2003). Protein O-fucosyltransferase 1 is an essential component of Notch signaling pathways. Proc. Natl. Acad. Sci. USA 100, 52345239. Sparks, E. E., Huppert, K. A., Brown, M. A., Washington, M. K. and Huppert, S. S. (2010). Notch signaling regulates formation of the three-dimensional architecture of intrahepatic bile ducts in mice. Hepatology 51, 1391-1400. Stahl, M., Uemura, K., Ge, C., Shi, S., Tashima, Y. and Stanley, P. (2008). Roles of Pofut1 and O-fucose in mammalian Notch signaling. J. Biol. Chem. 283, 13638-13651. Teng, Y., Liu, Q., Ma, J., Liu, F., Han, Z., Wang, Y. and Wang, W. (2006). Cloning, expression and characterization of a novel human CAP10-like gene hCLP46 from CD34(+) stem/progenitor cells. Gene 371, 7-15. Venken, K. J., He, Y., Hoskins, R. A. and Bellen, H. J. (2006). P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314, 1747-1751. Warthen, D. M., Moore, E. C., Kamath, B. M., Morrissette, J. J., Sanchez, P., Piccoli, D. A., Krantz, I. D. and Spinner, N. B. (2006). Jagged1 (JAG1) mutations in Alagille syndrome: increasing the mutation detection rate. Hum. Mutat. 27, 436-443. Watanabe, M., Muramatsu, T., Shirane, H. and Ugai, K. (1981). Discrete distribution of binding sites for Dolichos biflorus agglutinin (DBA) and for peanut agglutinin (PNA) in mouse organ tissues. J. Histochem. Cytochem. 29, 779-780. Whitworth, G. E., Zandberg, W. F., Clark, T. and Vocadlo, D. J. (2010). Mammalian Notch is modified by D-Xyl-{alpha}1-3-D-Xyl-{alpha}1-3-D-Glc{beta}1-O-Ser: implementation of a method to study O-glucosylation. Glycobiology 20, 287-299. Xue, Y., Gao, X., Lindsell, C. E., Norton, C. R., Chang, B., Hicks, C., GendronMaguire, M., Rand, E. B., Weinmaster, G. and Gridley, T. (1999). Embryonic lethality and vascular defects in mice lacking the Notch ligand Jagged1. Hum. Mol. Genet. 8, 723-730. Yang, L. T., Nichols, J. T., Yao, C., Manilay, J. O., Robey, E. A. and Weinmaster, G. (2005). Fringe glycosyltransferases differentially modulate Notch1 proteolysis induced by Delta1 and Jagged1. Mol. Biol. Cell 16, 927-942.
DEVELOPMENT
1934 RESEARCH ARTICLE
1
Table S1. Primers and primers/probe sets used in this study Name
F1* R1 F2 R2 JG1† JGKO2 SOL1 N2-L3‡ N2-L4 N2-L8 Rumi-for§ Rumi-rev KDELC1-for KDELC1-rev KDELC2-for KDELC2-rev β-actin-for β-actin-rev Mm00552419_m1¶ Mm00470005_m1 Mm01177482_m1 Mm01342805_m1 Mm00456108_g1 Mm00448865_m1 4319413E
Gene/application
Primer sequence
Rumi/genotyping Rumi/genotyping Rumi/genotyping Rumi/genotyping Jag1/genotyping Jag1/genotyping Jag1/genotyping Notch2/genotyping Notch2/genotyping Notch2/genotyping Rumi/RT-PCR Rumi/RT-PCR Kdelc1/RT-PCR Kdelc1/RT-PCR Kdelc2/RT-PCR Kdelc2/RT-PCR β-Actin/RT-PCR β-Actin /RT-PCR mRumi/qRT-PCR mKdelc1/qRT-PCR mKdelc2/qRT-PCR Hes1/qRT-PCR Hes2/qRT-PCR Hey1/qRT-PCR 18S/qRT-PCR
5’-GTTCTTGGCATTTCCACTACTGGG 5’-ATAGGGAACAGAGGCAATGTGG 5’-CTTGCAAAATGGCGTTACTTAAGC 5’-CCAATAAACCCTCTTGCAGTTGC 5’-TCTCACTCAGGCATGATAAACC 5’- TAACGGGGACTCCAGACAGGG 5’-TGGATGTGGAATGTGTGCGAG 5’-GCTCAGCTAGAGTGTTGTTCTTG 5’-TTTGTGGCCGTAACTTTCTCATG 5’-ATAACGCTAAACGTGCACTGGAG 5’-AGGTGTAGCTGCAAGCTTCCG 5’- TCCCAGTAACAGGTGATGTCATCC 5'-TTCACTAGAGTTGGAGTCCAGG 5'-GGATCAACAGTAGGGAAATGTGCC 5'-CCTTTCACCTAAAGAGCTGGTCCG 5'-AGCATCTGCTGGAGATTAATGCTGG 5’-AGCCATGTACGTAGCCATCC 5'-TTTGATGTCACGCACGATTT
*The F1-R1 pair only amplifies from the wild-type allele, whereas the F1-R2 and F2-R1 pairs amplify only from the mutant allele. PCR conditions were: 95°C for 15 minutes; 10 cycles of 94°C for 1 minute, 61.5°C for 45 seconds and 72°C for 1.5 minutes; 27 cycles of 94°C for 45 seconds, 61.5°C for 45 seconds and 72°C for 1.25 minutes; and 72°C for 10 minutes. † The JG1-JGKO2 pair was used for the wild-type allele; the JG1-SOL1 pair for the mutant allele (Xue et al., 1999) (C. Norton and T. Gridley, personal communication). PCR conditions were: 95°C for 15 minutes; 10 cycles of 94°C for 1 minute, 57°C for 45 seconds and 72°C for 1 minute; 30 cycles of 94°C for 1 minute, 57°C for 45 seconds and 72°C for 45 seconds; and 72°C 10 minutes. ‡ N2-L3 and N2-L8 primers were used for the wild-type allele, and N2-L3 and N2-L4 primers were used for the mutant allele (McCright et al., 2006). PCR conditions were: 95°C for 15 minutes; 10 cycles of 94°C for 1 minute, 61.5°C for 45 seconds and 72°C for 2.5 minutes; 27 cycles of 94°C for 1 minute, 61.5°C for 45 seconds and 72°C for 1.25 minutes; and 72°C for 10 minutes. DMSO (5%) was added to all of the above PCR mixes. § All of the RT-PCR primers used in this work can generate amplicons from both mouse and human cDNAs. ¶ All qRT-PCR primers/probe sets are from Applied Biosystems.
1 Table S2. List of mouse proteins with at least one consensus O-glucosylation motif Potential target
Number of consensus sequence
Notch2
17
Notch1
16
Notch3
15
Crumbs1 Notch4 Sushi Crumbs2 DNER Polydom Jag1
12 9 9 8 5 5 4
Jag2
4
Celsr3 Dll4
3 3
Celsr1
2
Celsr2 Cubilin Dlk1/Pref1
2 2
Dll1
2
Fat1
2
Fibrillin2* Slit1† Slit2† Agrin Amaco CD93 Dlk2 Factor VII‡ Factor IX
2 2 2 1 1 1 1 1 1
Factor X
1
Fat2 Fat4 Fibrillin1* Fibulin7 HABP2
1 1 1 1 1
HEG1
1
HGFA Multimerin Neurexin1d Neurexin2d Neurexin3§ PAMR1 Protein Z Slit3 Tsp1 Tsp2
1 1 1 1 1 1 1 1 1 1
Tsp3
1
Versican
1
Homozygous mutant phenotype
Die before E11.5; show widespread apoptosis (Hamada et al., 1999; McCright et al., 2001; McCright et al., 2006) Die before E10.5; exhibit cardiovascular and somitogenesis defects (Swiatek et al., 1994; Conlon et al., 1995) Viable and fertile; exhibit structural defects in adult arterial smooth muscle cells (Krebs et al., 2003; Domenga et al., 2004) Viable and fertile; exhibit light-induced retinal degeneration (van de Pavert et al., 2004) Viable and fertile; no gross developmental defects (Krebs et al., 2000) Knockout not published Knockout not published Viable; exhibit cerebellar dysfunction (Tohgo et al., 2006) Knockout not published Die ~E10.5; exhibit hemorrhage and vascular remodeling defects (Xue et al., 1999) Perinatal death due to craniofacial morphogenesis defects; also exhibit syndactily and T-cell defects (Jiang et al., 1998) Neonatal death; defects in axonal connections (Tissir et al., 2005) Die before E10.5; severe vascular defects (Duarte et al., 2004; Gale et al., 2004; Krebs et al., 2004) Perinatal lethal; neural tube defects, abnormal hair patterning (Curtin et al., 2003; Ravni et al., 2009) Viable and fertile; develop hydrocephalus by P21 (Tissir et al., 2010) Die between E7.5 and E13.5 with endodermal and mesodermal defects (Smith et al., 2006) Neonatal death, growth retardation, obesity (Moon et al., 2002) Die ~ E12; show hemorrhage, a hyperplastic CNS, and defects in the paraxial mesoderm (Hrabe de Angelis et al., 1997) Perinatal lethality; exhibit kidney glomerular defects, holoprosencephaly, and anophthalmia (Ciani et al., 2003) Viable and fertile; exhibit joint contractures and bilateral syndactily (Arteaga-Solis et al., 2001) Viable and fertile (Plump et al., 2002) Perinatal lethal; axon guidance defect (Plump et al., 2002) Die between E18 and birth, with severe defects in neuromuscular function (Gautam et al., 1996) Knockout not published Viable and fertile; no gross developmental defects (Norsworthy et al., 2004) Knockout not published Perinatal death due to hemorrhage; develop normally (Rosen et al., 1997) Viable and fertile; some animals die of hemorrhage (Kundu et al., 1998) Show three lethal phases: E11.5-E12.5, neonatal, and P5-P20; severe hemorrhage, normal vascular development (Dewerchin et al., 2000) Knockout not published Perinatal death; cystic kidney disease (Saburi et al., 2008) Early postnatal death due to aortic wall rupture (Pereira et al., 1997; Carta et al., 2006) Knockout not published Knockout not published Some embryos die, half of the pups die before weaning; cardiac defects, pulmonary hemorrhage (Kleaveland et al., 2009) Viable and fertile; no gross developmental defects (Itoh et al., 2004) Viable and fertile; no gross developmental defects (Specht and Schoepfer, 2004) Viable and fertile; subtle behavioral defects (Geppert et al., 1998; Missler et al., 2003) Viable and fertile (Missler et al., 2003) Viable and fertile (Missler et al., 2003) Knockout not published Viable and fertile; no gross developmental defects (Yin et al., 2000) Viable and fertile; congenital diaphragmatic hernia (Yuan et al., 2003) Viable and fertile; develop pneumonia (Lawler et al., 1998) Viable and fertile; show connective tissue abnormalities (Kyriakides et al., 1998) Viable and fertile; develop subtle and transient postnatal skeletal abnormalities (Hankenson et al., 2005) Die by E10.5 due to defects in the right heart chamber and endocardial cushion (Yamamura et al., 1997; Mjaatvedt et al., 1998)
To identify potential Rumi targets, two queries representing EGF repeats with a consensus Rumi target were used to search the Swiss-Prot and KEGG-GENES databases on the MOTIF search website (http://motif.genome.jp/MOTIF2.html): C-{C}-S-{C}-P-C-{C}(5,10)-C-{C}(1,70)-C-{C}(1,6)-C-{C}(2)-G-[FYW]-{C}(0,24)-C-x and C-{C}-S-{C}-P-C-{C}(5,10)-C-{C}(1,70)-C-{C}(1,6)-C-{C}(3)-[FYW]-{C}(0,21)-G-{C}(2)-C-x. The potential targets are listed based on the number of EGF repeats with consensus sequence and then alphabetically. Extensive NCBI searches were performed to find reports on mutant mice for each potential target. *Fibrillin 1, fibrillin 2 double knockout mice die between E14.5 and birth with aortic wall defects (Carta et al., 2006). † Slit1, Slit2 double-knockout mice show perinatal lethality and axon guidance defects (Plump et al., 2002). ‡ A serine-to-alanine mutation in the single O-glucosylation motif of the recombinant human Factor VII results in a 40% decrease in its clotting activity and a 50% decrease in its secretion (Bjoern et al., 1991; Bolt et al., 2007). § Neurexin 1, neurexin 2, neurexin 3 triple-knockouts are born but die on the first day with breathing difficulty (Missler et al., 2003).
2 Additional references Arteaga-Solis, E., Gayraud, B., Lee, S. Y., Shum, L., Sakai, L. and Ramirez, F. (2001). Regulation of limb patterning by extracellular microfibrils. J. Cell Biol. 154, 275-281. Bjoern, S., Foster, D. C., Thim, L., Wiberg, F. C., Christensen, M., Komiyama, Y., Pedersen, A. H. and Kisiel, W. (1991). Human plasma and recombinant factor VII. Characterization of O-glycosylations at serine residues 52 and 60 and effects of site-directed mutagenesis of serine 52 to alanine. J. Biol. Chem. 266, 11051-11057. Bolt, G., Steenstrup, T. D. and Kristensen, C. (2007). All post-translational modifications except propeptide cleavage are required for optimal secretion of coagulation factor VII. Thromb. Haemost. 98, 988-997. Carta, L., Pereira, L., Arteaga-Solis, E., Lee-Arteaga, S. Y., Lenart, B., Starcher, B., Merkel, C. A., Sukoyan, M., Kerkis, A., Hazeki, N. et al. (2006). Fibrillins 1 and 2 perform partially overlapping functions during aortic development. J. Biol. Chem. 281, 8016-8023. Ciani, L., Patel, A., Allen, N. D. and ffrench-Constant, C. (2003). Mice lacking the giant protocadherin mFAT1 exhibit renal slit junction abnormalities and a partially penetrant cyclopia and anophthalmia phenotype. Mol. Cell. Biol. 23, 3575-3582. Conlon, R. A., Reaume, A. G. and Rossant, J. (1995). Notch1 is required for the coordinate segmentation of somites. Development 121, 1533-1545. Curtin, J. A., Quint, E., Tsipouri, V., Arkell, R. M., Cattanach, B., Copp, A. J., Henderson, D. J., Spurr, N., Stanier, P., Fisher, E. M. et al. (2003). Mutation of Celsr1 disrupts planar polarity of inner ear hair cells and causes severe neural tube defects in the mouse. Curr. Biol. 13, 1129-1133. Dewerchin, M., Liang, Z., Moons, L., Carmeliet, P., Castellino, F. J., Collen, D. and Rosen, E. D. (2000). Blood coagulation factor X deficiency causes partial embryonic lethality and fatal neonatal bleeding in mice. Thromb. Haemost. 83, 185-190. Domenga, V., Fardoux, P., Lacombe, P., Monet, M., Maciazek, J., Krebs, L. T., Klonjkowski, B., Berrou, E., Mericskay, M., Li, Z. et al. (2004). Notch3 is required for arterial identity and maturation of vascular smooth muscle cells. Genes Dev. 18, 2730-2735. Duarte, A., Hirashima, M., Benedito, R., Trindade, A., Diniz, P., Bekman, E., Costa, L., Henrique, D. and Rossant, J. (2004). Dosage-sensitive requirement for mouse Dll4 in artery development. Genes Dev. 18, 2474-2478. Gale, N. W., Dominguez, M. G., Noguera, I., Pan, L., Hughes, V., Valenzuela, D. M., Murphy, A. J., Adams, N. C., Lin, H. C., Holash, J. et al. (2004). Haploinsufficiency of delta-like 4 ligand results in embryonic lethality due to major defects in arterial and vascular development. Proc. Natl. Acad. Sci. USA 101, 15949-15954. Gautam, M., Noakes, P. G., Moscoso, L., Rupp, F., Scheller, R. H., Merlie, J. P. and Sanes, J. R. (1996). Defective neuromuscular synaptogenesis in agrindeficient mutant mice. Cell 85, 525-535. Geppert, M., Khvotchev, M., Krasnoperov, V., Goda, Y., Missler, M., Hammer, R. E., Ichtchenko, K., Petrenko, A. G. and Sudhof, T. C. (1998). Neurexin I alpha is a major alpha-latrotoxin receptor that cooperates in alpha-latrotoxin action. J. Biol. Chem. 273, 1705-1710. Hamada, Y., Kadokawa, Y., Okabe, M., Ikawa, M., Coleman, J. R. and Tsujimoto, Y. (1999). Mutation in ankyrin repeats of the mouse Notch2 gene induces early embryonic lethality. Development 126, 3415-3424. Hankenson, K. D., Hormuzdi, S. G., Meganck, J. A. and Bornstein, P. (2005). Mice with a disruption of the thrombospondin 3 gene differ in geometric and biomechanical properties of bone and have accelerated development of the femoral head. Mol. Cell. Biol. 25, 5599-5606. Hrabe de Angelis, M., McIntyre, J., 2nd and Gossler, A. (1997). Maintenance of somite borders in mice requires the Delta homologue DII1. Nature 386, 717721. Itoh, H., Naganuma, S., Takeda, N., Miyata, S., Uchinokura, S., Fukushima, T., Uchiyama, S., Tanaka, H., Nagaike, K., Shimomura, T. et al. (2004). Regeneration of injured intestinal mucosa is impaired in hepatocyte growth factor activator-deficient mice. Gastroenterology 127, 1423-1435. Jiang, R., Lan, Y., Chapman, H. D., Shawber, C., Norton, C. R., Serreze, D. V., Weinmaster, G. and Gridley, T. (1998). Defects in limb, craniofacial, and thymic development in Jagged2 mutant mice. Genes Dev. 12, 1046-1057. Kleaveland, B., Zheng, X., Liu, J. J., Blum, Y., Tung, J. J., Zou, Z., Sweeney, S. M., Chen, M., Guo, L., Lu, M. M. et al. (2009). Regulation of cardiovascular development and integrity by the heart of glass-cerebral cavernous malformation protein pathway. Nat. Med. 15, 169-176. Krebs, L. T., Xue, Y., Norton, C. R., Sundberg, J. P., Beatus, P., Lendahl, U., Joutel, A. and Gridley, T. (2003). Characterization of Notch3-deficient mice: normal embryonic development and absence of genetic interactions with a Notch1 mutation. Genesis 37, 139-143. Krebs, L. T., Shutter, J. R., Tanigaki, K., Honjo, T., Stark, K. L. and Gridley, T. (2004). Haploinsufficient lethality and formation of arteriovenous malformations in Notch pathway mutants. Genes Dev. 18, 2469-2473. Kundu, R. K., Sangiorgi, F., Wu, L. Y., Kurachi, K., Anderson, W. F., Maxson, R. and Gordon, E. M. (1998). Targeted inactivation of the coagulation factor IX gene causes hemophilia B in mice. Blood 92, 168-174. Kyriakides, T. R., Zhu, Y. H., Smith, L. T., Bain, S. D., Yang, Z., Lin, M. T., Danielson, K. G., Iozzo, R. V., LaMarca, M., McKinney, C. E. et al. (1998). Mice that lack thrombospondin 2 display connective tissue abnormalities that are associated with disordered collagen fibrillogenesis, an increased vascular density, and a bleeding diathesis. J. Cell Biol. 140, 419-430. Lawler, J., Sunday, M., Thibert, V., Duquette, M., George, E. L., Rayburn, H. and Hynes, R. O. (1998). Thrombospondin-1 is required for normal murine pulmonary homeostasis and its absence causes pneumonia. J. Clin. Invest. 101, 982-992. Missler, M., Zhang, W., Rohlmann, A., Kattenstroth, G., Hammer, R. E., Gottmann, K. and Sudhof, T. C. (2003). Alpha-neurexins couple Ca2+ channels to synaptic vesicle exocytosis. Nature 423, 939-948. Mjaatvedt, C. H., Yamamura, H., Capehart, A. A., Turner, D. and Markwald, R. R. (1998). The Cspg2 gene, disrupted in the hdf mutant, is required for right cardiac chamber and endocardial cushion formation. Dev. Biol. 202, 56-66. Moon, Y. S., Smas, C. M., Lee, K., Villena, J. A., Kim, K. H., Yun, E. J. and Sul, H. S. (2002). Mice lacking paternally expressed Pref-1/Dlk1 display growth retardation and accelerated adiposity. Mol. Cell. Biol. 22, 5585-5592. Norsworthy, P. J., Fossati-Jimack, L., Cortes-Hernandez, J., Taylor, P. R., Bygrave, A. E., Thompson, R. D., Nourshargh, S., Walport, M. J. and Botto, M. (2004). Murine CD93 (C1qRp) contributes to the removal of apoptotic cells in vivo but is not required for C1q-mediated enhancement of phagocytosis. J. Immunol. 172, 3406-3414. Pereira, L., Andrikopoulos, K., Tian, J., Lee, S. Y., Keene, D. R., Ono, R., Reinhardt, D. P., Sakai, L. Y., Biery, N. J., Bunton, T. et al. (1997). Targetting of the gene encoding fibrillin-1 recapitulates the vascular aspect of Marfan syndrome. Nat. Genet. 17, 218-222. Plump, A. S., Erskine, L., Sabatier, C., Brose, K., Epstein, C. J., Goodman, C. S., Mason, C. A. and Tessier-Lavigne, M. (2002). Slit1 and Slit2 cooperate to prevent premature midline crossing of retinal axons in the mouse visual system. Neuron 33, 219-232. Ravni, A., Qu, Y., Goffinet, A. M. and Tissir, F. (2009). Planar cell polarity cadherin Celsr1 regulates skin hair patterning in the mouse. J. Invest. Dermatol. 129, 2507-2509. Rosen, E. D., Chan, J. C., Idusogie, E., Clotman, F., Vlasuk, G., Luther, T., Jalbert, L. R., Albrecht, S., Zhong, L., Lissens, A. et al. (1997). Mice lacking factor VII develop normally but suffer fatal perinatal bleeding. Nature 390, 290-294. Saburi, S., Hester, I., Fischer, E., Pontoglio, M., Eremina, V., Gessler, M., Quaggin, S. E., Harrison, R., Mount, R. and McNeill, H. (2008). Loss of Fat4 disrupts PCP signaling and oriented cell division and leads to cystic kidney disease. Nat. Genet. 40, 1010-1015. Smith, B. T., Mussell, J. C., Fleming, P. A., Barth, J. L., Spyropoulos, D. D., Cooley, M. A., Drake, C. J. and Argraves, W. S. (2006). Targeted disruption of cubilin reveals essential developmental roles in the structure and function of endoderm and in somite formation. BMC Dev. Biol. 6, 30. Specht, C. G. and Schoepfer, R. (2004). Deletion of multimerin-1 in alpha-synuclein-deficient mice. Genomics 83, 1176-1178. Swiatek, P. J., Lindsell, C. E., del Amo, F. F., Weinmaster, G. and Gridley, T. (1994). Notch1 is essential for postimplantation development in mice. Genes Dev. 8, 707-719. Tissir, F., Bar, I., Jossin, Y., De Backer, O. and Goffinet, A. M. (2005). Protocadherin Celsr3 is crucial in axonal tract development. Nat. Neurosci. 8, 451-457. Tissir, F., Qu, Y., Montcouquiol, M., Zhou, L., Komatsu, K., Shi, D., Fujimori, T., Labeau, J., Tyteca, D., Courtoy, P. et al. (2010). Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus. Nat. Neurosci. 13, 700-707. Tohgo, A., Eiraku, M., Miyazaki, T., Miura, E., Kawaguchi, S. Y., Nishi, M., Watanabe, M., Hirano, T., Kengaku, M. and Takeshima, H. (2006). Impaired cerebellar functions in mutant mice lacking DNER. Mol. Cell. Neurosci. 31, 326-333. van de Pavert, S. A., Kantardzhieva, A., Malysheva, A., Meuleman, J., Versteeg, I., Levelt, C., Klooster, J., Geiger, S., Seeliger, M. W., Rashbass, P. et al. (2004). Crumbs homologue 1 is required for maintenance of photoreceptor cell polarization and adhesion during light exposure. J. Cell Sci. 117, 4169-4177. Yamamura, H., Zhang, M., Markwald, R. R. and Mjaatvedt, C. H. (1997). A heart segmental defect in the anterior-posterior axis of a transgenic mutant mouse. Dev. Biol. 186, 58-72. Yin, Z. F., Huang, Z. F., Cui, J., Fiehler, R., Lasky, N., Ginsburg, D. and Broze, G. J., Jr. (2000). Prothrombotic phenotype of protein Z deficiency. Proc. Natl. Acad. Sci. USA 97, 6734-6738. Yuan, W., Rao, Y., Babiuk, R. P., Greer, J. J., Wu, J. Y. and Ornitz, D. M. (2003). A genetic model for a central (septum transversum) congenital diaphragmatic hernia in mice lacking Slit3. Proc. Natl. Acad. Sci. USA 100, 5217-5222.